120
\$\begingroup\$

Update: The winner has been decided, but the challenge is not over!

Finally, nearly 3 months after the question first started, someone has remained the last answerer for more than a week! Congratulations to jimmy23013 with his P1eq answer!

There are still however 8 characters left: 48KSaclw. If anyone is really ambitious they can keep on trying with those :D

Thanks a ton to everyone who participated, especially those of you who kept the contest going so long with multiple answers, notably KennyTM with a whopping 25 answers!!

Also, thanks to anyone who kept the answer list up to date, it was a great help :) (especially since I've been away from SE for a couple months :P).


Original Question:

In 2005 the American Film Institute produced AFI's 100 Years...100 Movie Quotes, a list of the best quotes in American cinema. Here they are listed exactly as they should be used in this challenge:

(answer  6) 1. "Frankly, my dear, I don't give a damn." - Rhett Butler
(answer  7) 2. "I'm gonna make him an offer he can't refuse." - Vito Corleone
(answer  5) 3. "You don't understand! I coulda had class. I coulda been a contender. I could've been somebody, instead of a bum, which is what I am." - Terry Malloy
(answer  3) 4. "Toto, I've a feeling we're not in Kansas anymore." - Dorothy Gale
5. "Here's looking at you, kid." - Rick Blaine
(answer  2) 6. "Go ahead, make my day." - Harry Callahan
(answer 11) 7. "All right, Mr. DeMille, I'm ready for my close-up." - Norma Desmond
(answer  8) 8. "May the Force be with you." - Han Solo
(answer 12) 9. "Fasten your seatbelts. It's going to be a bumpy night." - Margo Channing
(answer 13) 10. "You talking to me?" - Travis Bickle
(answer 16) 11. "What we've got here is failure to communicate." - Captain
(answer 15) 12. "I love the smell of napalm in the morning." - Lt. Col. Bill Kilgore
(answer  4) 13. "Love means never having to say you're sorry." - Jennifer Cavilleri Barrett
14. "The stuff that dreams are made of." - Sam Spade
(answer 18) 15. "E.T. phone home." - E.T.
(answer 20) 16. "They call me Mister Tibbs!" - Virgil Tibbs
17. "Rosebud." - Charles Foster Kane
(answer 10) 18. "Made it, Ma! Top of the world!" - Arthur "Cody" Jarrett
(answer 17) 19. "I'm as mad as hell, and I'm not going to take this anymore!" - Howard Beale
(answer 25) 20. "Louis, I think this is the beginning of a beautiful friendship." - Rick Blaine
(answer 26) 21. "A census taker once tried to test me. I ate his liver with some fava beans and a nice Chianti." - Hannibal Lecter
(answer  9) 22. "Bond. James Bond." - James Bond
(answer 22) 23. "There's no place like home." - Dorothy Gale
(answer 29) 24. "I am big! It's the pictures that got small." - Norma Desmond
25. "Show me the money!" - Rod Tidwell
(answer 31) 26. "Why don't you come up sometime and see me?" - Lady Lou
(answer 27) 27. "I'm walking here! I'm walking here!" - "Ratso" Rizzo
(answer 14) 28. "Play it, Sam. Play 'As Time Goes By.'" - Ilsa Lund
(answer 28) 29. "You can't handle the truth!" - Col. Nathan R. Jessup
(answer 23) 30. "I want to be alone." - Grusinskaya
(answer 30) 31. "After all, tomorrow is another day!" - Scarlett O'Hara
(answer  1) 32. "Round up the usual suspects." - Capt. Louis Renault
(answer 24) 33. "I'll have what she's having." - Customer
(answer 36) 34. "You know how to whistle, don't you, Steve? You just put your lips together and blow." - Marie "Slim" Browning
(answer 19) 35. "You're gonna need a bigger boat." - Martin Brody
(answer 39) 36. "Badges? We ain't got no badges! We don't need no badges! I don't have to show you any stinking badges!" - "Gold Hat"
(answer 40) 37. "I'll be back." - The Terminator
(answer 33) 38. "Today, I consider myself the luckiest man on the face of the earth." - Lou Gehrig
(answer 37) 39. "If you build it, he will come." - Shoeless Joe Jackson
(answer 43) 40. "My mama always said life was like a box of chocolates. You never know what you're gonna get." - Forrest Gump
(answer 34) 41. "We rob banks." - Clyde Barrow
(answer 38) 42. "Plastics." - Mr. Maguire
43. "We'll always have Paris." - Rick Blaine
(answer 49) 44. "I see dead people." - Cole Sear
(answer 21) 45. "Stella! Hey, Stella!" - Stanley Kowalski
(answer 32) 46. "Oh, Jerry, don't let's ask for the moon. We have the stars." - Charlotte Vale
(answer 35) 47. "Shane. Shane. Come back!" - Joey Starrett
(answer 42) 48. "Well, nobody's perfect." - Osgood Fielding III
(answer 51) 49. "It's alive! It's alive!" - Henry Frankenstein
(answer 41) 50. "Houston, we have a problem." - Jim Lovell
(answer 45) 51. "You've got to ask yourself one question: 'Do I feel lucky?' Well, do ya, punk?" - Harry Callahan
(answer 55) 52. "You had me at "hello."" - Dorothy Boyd
(answer 46) 53. "One morning I shot an elephant in my pajamas. How he got in my pajamas, I don't know." - Capt. Geoffrey T. Spaulding
(answer 44) 54. "There's no crying in baseball!" - Jimmy Dugan
(answer 59) 55. "La-dee-da, la-dee-da." - Annie Hall
(answer 60) 56. "A boy's best friend is his mother." - Norman Bates
(answer 47) 57. "Greed, for lack of a better word, is good." - Gordon Gekko
(answer 56) 58. "Keep your friends close, but your enemies closer." - Michael Corleone
(answer 48) 59. "As God is my witness, I'll never be hungry again." - Scarlett O'Hara
(answer 50) 60. "Well, here's another nice mess you've gotten me into!" - Oliver
(answer 65) 61. "Say "hello" to my little friend!" - Tony Montana
(answer 66) 62. "What a dump." - Rosa Moline
(answer 52) 63. "Mrs. Robinson, you're trying to seduce me. Aren't you?" - Benjamin Braddock
(answer 61) 64. "Gentlemen, you can't fight in here! This is the War Room!" - President Merkin Muffley
(answer 68) 65. "Elementary, my dear Watson." - Sherlock Holmes
(answer 64) 66. "Take your stinking paws off me, you damned dirty ape." - George Taylor
(answer 53) 67. "Of all the gin joints in all the towns in all the world, she walks into mine." - Rick Blaine
(answer 72) 68. "Here's Johnny!" - Jack Torrance
(answer 71) 69. "They're here!" - Carol Anne Freeling
(answer 73) 70. "Is it safe?" - Dr. Christian Szell
(answer 54) 71. "Wait a minute, wait a minute. You ain't heard nothin' yet!" - Jakie Rabinowitz/Jack Robin
(answer 77) 72. "No wire hangers, ever!" - Joan Crawford
(answer 67) 73. "Mother of mercy, is this the end of Rico?" - Cesare Enrico "Rico" Bandello
(answer 70) 74. "Forget it, Jake, it's Chinatown." - Lawrence Walsh
(answer 74) 75. "I have always depended on the kindness of strangers." - Blanche DuBois
(answer 78) 76. "Hasta la vista, baby." - The Terminator
(answer 75) 77. "Soylent Green is people!" - Det. Robert Thorn
(answer 76) 78. "Open the pod bay doors, HAL." - Dave Bowman
(answer 80) 79. Striker: "Surely you can't be serious." Rumack: "I am serious...and don't call me Shirley." - Ted Striker and Dr. Rumack
(answer 84) 80. "Yo, Adrian!" - Rocky Balboa
(answer 81) 81. "Hello, gorgeous." - Fanny Brice
(answer 83) 82. "Toga! Toga!" - John "Bluto" Blutarsky
(answer 63) 83. "Listen to them. Children of the night. What music they make." - Count Dracula
(answer 87) 84. "Oh, no, it wasn't the airplanes. It was Beauty killed the Beast." - Carl Denham
(answer 88) 85. "My precious." - Gollum
(answer 86) 86. "Attica! Attica!" - Sonny Wortzik
(answer 57) 87. "Sawyer, you're going out a youngster, but you've got to come back a star!" - Julian Marsh
(answer 82) 88. "Listen to me, mister. You're my knight in shining armor. Don't you forget it. You're going to get back on that horse, and I'm going to be right behind you, holding on tight, and away we're gonna go, go, go!" - Ethel Thayer
(answer 58) 89. "Tell 'em to go out there with all they got and win just one for the Gipper." - Knute Rockne
(answer 90) 90. "A martini. Shaken, not stirred." - James Bond
(answer 85) 91. "Who's on first." - Dexter
(answer 62) 92. "Cinderella story. Outta nowhere. A former greenskeeper, now, about to become the Masters champion. It looks like a mirac...It's in the hole! It's in the hole! It's in the hole!" - Carl Spackler
(answer 69) 93. "Life is a banquet, and most poor suckers are starving to death!" - Mame Dennis
(answer 89) 94. "I feel the need - the need for speed!" - Lt. Pete "Maverick" Mitchell and Lt. Nick "Goose" Bradshaw
(answer 79) 95. "Carpe diem. Seize the day, boys. Make your lives extraordinary." - John Keating
(answer 91) 96. "Snap out of it!" - Loretta Castorini
(answer 92) 97. "My mother thanks you. My father thanks you. My sister thanks you. And I thank you." - George M. Cohan
(answer 93) 98. "Nobody puts Baby in a corner." - Johnny Castle
(answer 94) 99. "I'll get you, my pretty, and your little dog, too!" - Wicked Witch of the West
(answer 95) 100. "I'm the king of the world!" - Jack Dawson

(Feel free to mark quotes as used.)

There are 95 printable ASCII characters (hex codes 20 to 7E), that's pretty close to 100:

 !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~

In this challenge users will take turns writing programs that print one of the movie quotes using a new programming language and a smaller subset of printable ASCII each time.

How This Works

I've already submitted the first answer and I've labeled it 95 since I was allowed to use all 95 printable ASCII characters in my program. It is a Python program that prints the 100th quote, "I'm the king of the world!" - Jack Dawson, to stdout.

The second person to answer needs to choose a new quote, a new programming language, and one of the 95 printable ASCII characters to exclude from their code. They must write a program without using this character that prints their chosen quote to stdout. They should mark their answer as 94 since they had 94 printable ASCII characters to work with (think of it like a countdown).

The third person to answer must choose a quote and language that haven't been used in any previous answers (only 95 and 94 in this case), and a new character to forgo. They must not use this character or any previously forbidden characters in their code. They mark their answer as 93.

This answering process continues like this until all printable ASCII characters are forbidden and someone gives the "1" answer, or much more likely, no one can figure out how to answer again.

Rules (please read carefully)

It's important to understand that only one person can answer at a time and each answer depends on the one before it. There should never be two answers with the same number, quote, or programming language.

There's bound to be clashing answers submitted at the same time, and that's ok. If that happens the person who technically answered later should quickly (like 10 min or less) delete their post or edit it so it becomes the next answer. Otherwise, don't edit code unless truly necessary. Editing posts to only fix formatting is encouraged.

Specific Rules

  • A user who just answered must wait at least an hour before answering again.
  • A user may not answer twice in a row.
  • The quote number you choose must not be more than 5 below your answer number. For example, answer 90 can choose any unused quote from number 85 to 100. This leaves the better quotes for the harder answers. Other than this rule the quote numbering is irrelevant.
  • Programs may only contain tabs, newlines, and the printable ASCII character that are not forbidden so far. (Tabs and newlines are never forbidden.)
  • There is no program length limit, but there may not be more that 64 tabs or 64 newlines in your program.
  • Languages are considered distinct if they are commonly referred to by different names. Different versions of programming languages are not considered distinct. (Markup languages like HTML do count but full on programming languages are preferred.) Your language must have existed prior to the start of this contest.
  • If your language does not have stdout use some similar text output mechanism.
  • Your program should not take input or have unexpected side effects like creating files.

Please make sure your program is valid. It should be able to run as a full program as is, not just in a REPL environment.

Note that the "quote" you must output includes the quotation marks and the person who said it (but not the quote number). Your program should solely produce your quote exactly as it appears in the list above (a leading/trailing newline is fine).

Formatting

Please format your answers like this, {stuff in curly braces} needs to be replaced:

#{answer number}. {language}, uses no <code>{the forbidden character you just chose}</code>

    {program}

Output is quote {quote number}:

    {program output, should be identical to quote}

[Previously forbidden:]({url of previous answer (hit "share" just below it)}) <code>{the previous answerer's forbidden character followed by his previously forbidden list}</code>

{anything else you wish to say}

The <code> tags can be replaced with backticks (`) as long as no backtick occurs within them.

Scoring

The communal goal of this challenge is to keep answers coming for as long as possible.

The official winner is the user who answers last, after a week of no additional answers. I will accept their last answer.

Answer List (newest first)

  1. 4 Progressive Unary
  2. a Bueue
  3. c Udage
  4. S 1L_a105
  5. w Binaryfuck
  6. K Subskin
  7. l 23

  1. n P1eq
  2. t Addleq
  3. 9 x86 Machine Code
  4. r BSM
  5. D ShaFuck 0.2
  6. u Villmark
  7. O PDP-11 machine code
  8. f ProgFk
  9. i NUMPAD
  10. H Tri
  11. 2 ferNANDo
  12. P Pointy
  13. m Subleq
  14. G FlogScript
  15. ? Nqubl
  16. % Glypho
  17. ! 3var
  18. q ETA
  19. j BrainSpace 1.0
  20. V Insomnia
  21. ` asdf
  22. 6 Lazy K
  23. C !Py!Batch 1.5
  24. T Fuckfuck
  25. F PoGo
  26. R Golunar
  27. b 6502 machine code + Apple II System Monitor
  28. Y Headsecks
  29. I BRB
  30. U Braincrash
  31. Z Ecstatic
  32. M Farm
  33. A Enema
  34. L ADJUST
  35. $ Beatnik
  36. N Rebmu
  37. g Dupdog
  38. B Gammaplex
  39. J Fuck4
  40. 5 A0A0
  41. W gs2
  42. : l33t
  43. h Tonoco
  44. E Malbolge
  45. k D1ffe7e45e
  46. 1 evil
  47. Q CaneCode
  48. d Grass
  49. # URSL
  50. | Burlesque
  51. x Emmental
  52. ~ Applesoft BASIC
  53. ^ Forth
  54. 7 80386 machine code + DOS
  55. _ Argh!
  56. v Rexx
  57. } AlphaBeta
  58. o Super Stack!
  59. e Pyth
  60. z Plain TeX
  61. > WASD
  62. ] POSIX shell
  63. & Gibberish
  64. / GolfScript
  65. * x86_64 assembly
  66. 0 AppleScript
  67. X Deadfish~
  68. , Spoon
  69. - oOo CODE
  70. = J
  71. @ Mathematica
  72. . Perl
  73. + DNA#
  74. < Pi
  75. ) Postscript
  76. [ ABC
  77. s dc
  78. { HTML
  79. ( Unary
  80. ; Ook!
  81. ' CJam
  82.   PHP
  83. " Brainfuck
  84. \ Marbelous
  85. 3 C++
  86. y Ruby
  87. p JavaScript
  88.      Python

(Feel free to edit if incorrect or out of date)

This question works best when you sort by "oldest".

NOTE: Like my last question, this is a test of a new challenge type where each answer depends on the last and increases in difficulty. Come to chat or meta to discuss either question or the idea in general.

\$\endgroup\$
12
  • \$\begingroup\$ How strange. Everyone knows how to do #2, but nobody wants to do it (mostly because #1 would become impossible). If this challenge was rebooted, it would probably be finishable. \$\endgroup\$ Mar 3 '17 at 5:41
  • \$\begingroup\$ I will do this! \$\endgroup\$ May 11 '17 at 2:11
  • \$\begingroup\$ @CalculatorFeline how do you do 2? \$\endgroup\$ May 31 '17 at 17:23
  • \$\begingroup\$ Same way you do #1. Lenguage. Of course, that would kill the challenge. \$\endgroup\$ May 31 '17 at 17:26
  • \$\begingroup\$ @CalculatorFeline Lenguage was made up for this challenge, which is a standard loophole. (See the link in the first line.) \$\endgroup\$
    – jimmy23013
    Jun 4 '17 at 3:58

95 Answers 95

8
\$\begingroup\$

20. Subleq (uses no m)

(It has 30 newlines and 63 tabs.)

28  42  4
9999    48  29
44  9999    42
222 8   48
24  22  9
9   9   9
9   9   9
9   48  222
2   29  44
9999    222 8
9999    222 222
44  9   9
9   9   9
9   9   9
84  9   49
222 8   9
9   29489   9429
49429   28  8
8929    444 998
849 849 8929
848 28  8929
4882    24  428
289 28  429
8929    9429    24
2929    2929    428
924 29489   8929
84  8929    9289
24  429 992
24  849 8929
9429    24  2929
2929    428 4949    4829

Output is quote 16:

"They call me Mister Tibbs!" - Virgil Tibbs

Previously forbidden:

?!"#$%&'()*+,-./013567:;<=>@[\]^_` AbBCdeEFgGhIjJkLMNopqQRsTUvVWxXyYzZ{|}~

Remaining characters:

  • Symbols: none
  • Numbers: 2 4 89
  • Uppercase: D H K OP S
  • Lowercase: a c f i l n r tu w

Tested here. Click ASQ -> SQ to compile and execute SQ to run. It will compile to exactly the same code with different spacing so it doesn't matter if you run it without compiling.

Subleq is a Turing complete language with only one instruction: subleq. It takes three numbers a, b and c, subtract a from b and jumps to c if the result in b is zero or negative. Subtracting from address -1 will output a character, and jumping to a negative address will end the program.

It doesn't have to jump to addresses which are multiples of 3 or starting a line. And it doesn't matter how you arrange the code. But the compiler will compile it to something different if there are less than 3 numbers in a line.

Explanation:

addr0: 28 42 4 9999           # Get 84 - 222 = -138.
addr4: 48 29 44 9999          # Get 8 - 9 = -1.
addr8: 42 222 8               # Repeatedly add 138 until positive.
addr11: 48 24 22              # Make sure the jumping target address to end the program is negative.
addr14: 9 9 9 9 9 9 9 9       # Useless.
addr22: 48 222 2              # Subtract by 9 and end the program if negative.
addr25: 29 44 9999            # Increase the data pointer.
addr28: 222 8 9999            # Output the character.
addr31: 222 222 44            # Zero the character register.
addr34: 9 9 9 9 9 9 9 9 84 9  # 84 is for storing the divisor 138, negated.
addr44: 49 222 8 9 9          # Subtract the character register by the data. The last 9 is for getting -1.
addr49: 29489 9429 49429 28 8 8929 444 998 849 849 8929 848 28 8929 4882 24 428 289 28 429 8929 9429 24 2929 2929 428 924 29489 8929 84 8929 9289 24 429 992 24 849 8929 9429 24 2929 2929 428 4949 4829

9999s and all 9s except the last one are useless. They can be any numbers.

For each number x on the last line, the character code from the original string is (-x - 9) % 138, ended with -8.

\$\endgroup\$
1
  • \$\begingroup\$ I tried Fission before realizing both A and Y are blocked, which seemed making this impossible. \$\endgroup\$
    – jimmy23013
    Nov 29 '14 at 10:59
8
\$\begingroup\$

3. Udage (uses no c)

There must not be any trailing new lines.

a8aaaa844484aaaaa8484844aaaaa8848888aaaaa8884844aaaaa8848888aaaaa848844aaaaa844444aaaaa8448448aaaaa844888aaaaa8884884aaaaa8844848aaaaa844444aaaaa8844448aaaaa844444aaaaa8844884aaaaa8844848aaaaa8844848aaaaa8848844aaaaa8848448aaaaa8848884aaaaa8844888aaaaa844444aaaaa8884888aaaaa8844848aaaaa844888aaaaa8884484aaaaa8844848aaaaa844444aaaaa8848884aaaaa8848888aaaaa8884844aaaaa844444aaaaa8848448aaaaa8848884aaaaa844444aaaaa8448488aaaaa8844448aaaaa8848884aaaaa8884488aaaaa8844448aaaaa8884488aaaaa844444aaaaa8844448aaaaa8848884aaaaa8888448aaaaa8848848aaaaa8848888aaaaa8884484aaaaa8844848aaaaa848884aaaaa844484aaaaa844444aaaaa848848aaaaa844444aaaaa8444844aaaaa8848888aaaaa8884484aaaaa8848888aaaaa8884844aaaaa8848444aaaaa8888448aaaaa844444aaaaa8444888aaaaa8844448aaaaa8848844aaaaa8844848a

Output is quote 4:

"Toto, I've a feeling we're not in Kansas anymore." - Dorothy Gale

Previously forbidden:

?!"#$%&'()*+,-./01235679:;<=>@[\]^_` AbBCdDeEfFgGhHiIjJkKlLmMnNoOpPqQrRsStTuUvVwWxXyYzZ{|}~

Remaining characters: 4 8 a


Udage can be written in any symbols which makes it perfect for this challenge (Glypho used in answer 23 is similar). The length of each run of symbol determines the operation:

  • A single character x toggles the bit value of the variable x (0 ↔ 1)
  • If x is 1, the sequence xxxx…x will output the character composed by the binary digits in the "…". For instance, if y == 1 and z == 0, then xxxxyzzyzyx will print 0b100101 i.e. '%'.

Therefore the structure of the program is simply:

  1. a8 — set a to 1 to allow output, set 4 to 0 and 8 to 1 for the binary digits
  2. aaaa844484a — prints the character "
  3. aaaa8484844a — and so on…

Generator (Python 3):

quote = '''"Toto, I've a feeling we're not in Kansas anymore." - Dorothy Gale'''
print('a8', end='')
for char in quote:
    digits = bin(ord(char))[2:].translate({0x30: '4', 0x31: '8'})
    print('aaaa', digits, 'a', end='', sep='')
\$\endgroup\$
8
\$\begingroup\$

2. Bueue, first version (uses no a)

It works only in the interpreter in this revision of the esolangs page, which has a bug that can end the program with an error. It prints the quote with an infinite stream of garbage in the latest interpreter.

84848484848488488484848848488484848888488848888848488484848484848884848484884888488484848488848488488488848484848848884848848484848848884848484884848484848488848884884888484848488488848848884888484884884848848484848484888488848848888848488484884848484848488848488484848884848484884888884848848488488884848488484848848484884848484848484884888488484884848484848488484884848484888484848488488884848848488884848848488888484884848848484848484884848484888488848484848848884888484848884888484848884848484884888488484848488848484848848884888848484848488488444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888484448888888884448

Output is quote 6:

"Go ahead, make my day." - Harry Callahan

Previously forbidden:

?!"#$%&'()*+,-./01235679:;<=>@[\]^_` AbBcCdDeEfFgGhHiIjJkKlLmMnNoOpPqQrRsStTuUvVwWxXyYzZ{|}~

Remaining characters: 4 8

Generator

This program is generated using the following CJam program. Unfortunately I got it by trial and error and there are some hardcoded numbers that works only for this quote. It won't work if you replace the quote with something else.

"\"Go ahead, make my day.\" - Harry Callahan
":Q{i256+2b1>}%s0'1t'0/"06"*si
4/"1390"Q,*1>W<+si4*'1"06"6*+\+si4/
"02"'7275*"65139027777777639"]si32*

Explanations

The following subprograms are evaluated:

84848484848488488484848848488484848888488848888848488484848484848884848484884888488484848488848488488488848484848848884848848484848848884848484884848484848488848884884888484848488488848848884888484884884848848484848484888488848848888848488484884848484848488848488484848884848484884888884848848488488884848488484848848484884848484848484884888488484884848484848488484884848484888484848488488884848848488884848848488888484884848848484848484884848484888488848484848848884888484848884888484848884848484884888488484848488848484848848884888848484848488488444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448444844484448888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888484448888888884448

The first 8 does nothing because the queue is empty. The first 4 causes an error and quits this subprogram.

42424242424244244242424424244242424444244424444424244242424242424442424242442444244242424244424244244244424242424424442424424242424424442424242442424242424244424442442444242424244244424424442444242442442424424242424242444244424424444424244242442424242424244424244242424442424242442444442424424244244442424244242424424242442424242424242442444244242442424242424244242442424242444242424244244442424424244442424424244444242442424424242424242442424242444244424242424424442444242424442444242424442424242442444244242424244424242424424442444424242424244244222422242224222422242224222422242224222422242224222422242224222422242224222422242224222422242224222422242224222422242224222422242224222422242224222422242224222422242224444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444242224444444442224

The first 4 causes an error and quits this subprogram.

21212121212122122121212212122121212222122212222212122121212121212221212121221222122121212122212122122122212121212212221212212121212212221212121221212121212122212221221222121212122122212212221222121221221212212121212121222122212212222212122121221212121212122212122121212221212121221222221212212122122221212122121212212121221212121212121221222122121221212121212122121221212121222121212122122221212212122221212212122222121221212212121212121221212121222122212121212212221222121212221222121212221212121221222122121212122212121212212221222212121212122122111211121112111211121112111211121112111211121112111211121112111211121112111211121112111211121112111211121112111211121112111211121112111211121112111211121112111211121112222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222121112222222221112

It simply pushes a lot of 1s and ignore all the 2s.

1060606060606
10610606061060610606061110611061111060610606060606061106060606106110610606060611060610610611060606061061106061060606061061106060606106060606060611061106106110606060610611061061106110606106106061060606060606110611061061111060610606106060606060611060610606061106060606106111106061060610611106060610606061060606106060606060606106110610606106060606060610606106060606110606060610611106061060611106061060611110606106061060606060606106060606110611060606061061106110606061106110606061106060606106110610606060611060606061061106111060606060610610
55605560556055605560556055605560556055605560556055605560556055605560556055605560556055605560556055605560556055605560556055605560556055605560556055605560556055605560556111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111060556111111110556

The second line encodes the quote. 1 pushes 1. 06 pushes 0 and changes something that doesn't matter. The first line pushes something else so that the actual code in the final subprogram begins exactly when the quote is at the front of the queue.

5303030303030530530303053030530303055530553055553030530303030303055303030305305530530303030553030530530553030303053055303053030303053055303030305303030303030553055305305530303030530553053055305530305305303053030303030305530553053055553030530305303030303030553030530303055303030305305555303053030530555303030530303053030305303030303030305305530530305303030303030530305303030305530303030530555303053030555303053030555530305303053030303030305303030305530553030303053055305530303055305530303055303030305305530530303030553030303053055305553030303030530527802780278027802780278027802780278027802780278027802780278027802780278027802780278027802780278027802780278027802780278027802780278027802780278027802780278027802780278055555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555530278055555555278

5 rotates an element, and 3 causes an error and quits this subprogram.

265151515151526526515152651526515152776527652777651526515151515152765151515265276526515151527651526526527651515152652765152651515152652765151515265151515151527652765265276515151526527652652765276515265265152651515151515276527652652777651526515265151515151527651526515152765151515265277765152651526527765151526515152651515265151515151515265276526515265151515151526515265151515276515151526527765152651527765152651527776515265152651515151515265151515276527651515152652765276515152765276515152765151515265276526515151527651515152652765277651515151526526
39013901390139013901390139013901390139013901390139013901390139013901390139013901390139013901390139013901390139013901390139013901390139013901390139013901390139013901390
277777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777651390
27777777639

The first line does something random: it removes, rotates and pushes some elements. After that, everything pushed before the actual code is either removed from the queue, or rotated to the end of the queue.

The second line is for printing the data. 01 pushes something at the end of the queue, but doesn't matter. 3 could trigger a loop but that never happens because the first bit of every character in the quote is 0. 9 dequeues and prints 8 bits as a character.

The third line removes elements in a loop. It would repeat if the front of the queue is 1 after an iteration. I made it remove so much things in one iteration so that it only needs to run for 3 iterations, to make it more likely that I could find a program that the front of queue always happens to be the right value. The 9 after the loop does nothing because there are less than 8 elements in the queue at that point.

In the fourth line the 7s clear the queue, and the 3 causes an unchecked error when the queue is empty, which quits the whole program.

\$\endgroup\$
8
\$\begingroup\$

1. Progressive Unary (uses no 4)

The program consists of exactly 2130691772666389774389011818129432977526724054595685774072956807220340187754304344216170850474741825084738264024483125639102366732655921717750240644490284886585962997427932957194151233773238138826867657234233319542153892729223723713050148830827990932577158473558351770035220237198845372011140540236617061039134694993085927484693315515564905404685624754504677002990899546806981073411560009765942646584748262443625075334590374146800896620084838828846593051116848347417777214960627252153699850863043331541162486725625476864531564012190733203044734594521962297876104066432536535668411493346287828832810901078480818727197899744852589810133773624066622420226015624219902142535668225959682605837151376445379519636 8s (2.13 × 10705 bytes):

88888888888888888888888888888888888888888888888888888888888888888888888888888888888888888…

Output is quote 32:

"Round up the usual suspects." - Capt. Louis Renault

Previously forbidden:

?!"#$%&'()*+,-./01235679:;<=>@[\]^_` aAbBcCdDeEfFgGhHiIjJkKlLmMnNoOpPqQrRsStTuUvVwWxXyYzZ{|}~

Remaining characters: 8


Progressive Unary is a variant of Unary proposed by esolangs user Quintopia on 2010 Sept 3rd. Unlike Unary which only permits the character 0, Progressive Unary requires arbitrary character used as its "one" character, as long as it is distinct from other programs on the same tape. The point of the requirement was to effectively find the length of the program in O(log n) steps on the random-access tape. So it is equivalent to Lenguage, except it is not designed for this challenge, loopholing around the loophole (it also uses a different encoding than Lenguage).


The equivalent brainfuck program is:

>+++++[-<+++++++>]<-.
>++++++[-<++++++++>]<.
>+++++[-<++++++>]<-.
++++++.
-------.
----------.
>++++++++++[-<------->]<++.
>++++++++++++[-<+++++++>]<+.
-----.
>++++++++++[-<-------->]<.
>++++++++++++[-<+++++++>]<.
------------.
---.
>++++++++++[-<------->]<+.
>++++++++++++[-<+++++++>]<+.
--.
++.
>+++++[-<---->]<.
+++++++++++.
>+++++++++++[-<------->]<+.
>++++++++++++[-<+++++++>]<-.
++.
--.
---.
-----------.
--.
>++++[-<++++>]<+.
-.
>++++++++++[-<------->]<+.
------------.
--.
+++++++++++++.
-------------.
>+++++[-<+++++++>]<.
>+++++[-<++++++>]<.
+++++++++++++++.
++++.
>++++++++++[-<------->]<.
--------------.
>+++++[-<+++++++++>]<-.
>+++++[-<+++++++>]<.
++++++.
------------.
++++++++++.
>++++++++++++[-<------->]<+.
>+++++++[-<+++++++>]<+.
>+++++[-<++++>]<-.
+++++++++.
-------------.
>+++++[-<++++>]<.
---------.
++++++++.

Python 3 generator:

# Cost of factorization of N to A*B+C is "7+A+B+|C|"
#
# {#, Minimize[{7 + a + b + Abs[c], # == a b + c && a > 0 && b > 0}, {a, b, c}, Integers]} & /@ {17, 19, 20, 29, 30, 34, 35, 44, 48, 50, 68, 69, 70, 76, 80, 83, 84, 85}

BF_FACTORIZATIONS = {
    17: (4, 4, 1),
    19: (5, 4, -1),
    20: (5, 4, 0),
    29: (5, 6, -1),
    30: (5, 6, 0),
    34: (5, 7, -1),
    35: (5, 7, 0),
    44: (5, 9, -1),
    48: (6, 8, 0),
    50: (7, 7, 1),
    68: (10, 7, -2),
    69: (10, 7, -1),
    70: (10, 7, 0),
    76: (11, 7, -1),
    80: (10, 8, 0),
    83: (12, 7, -1),
    84: (12, 7, 0),
    85: (12, 7, 1),
}

BF_DELTA_CONSTS = {0: ''}
for i in range(16):
    BF_DELTA_CONSTS[i] = '+'*i
    BF_DELTA_CONSTS[-i] = '-'*i
for n, (a, b, c) in BF_FACTORIZATIONS.items():
    BF_DELTA_CONSTS[n] = '>' + '+'*a + '[-<' + '+'*b + '>]<' + BF_DELTA_CONSTS[c]
    BF_DELTA_CONSTS[-n] = '>' + '+'*a + '[-<' + '-'*b + '>]<' + BF_DELTA_CONSTS[-c]

bf = ''
init = 0
for c in map(ord, '"Round up the usual suspects." - Capt. Louis Renault'):
    (delta, init) = (c - init, c)
    bf += BF_DELTA_CONSTS[delta]
    bf += '.\n'

num = '1' + bf.translate({
    ord('>'): '0',
    ord('<'): '1',
    ord('+'): '2',
    ord('-'): '3',
    ord('.'): '4',
    ord(','): '5',
    ord('['): '6',
    ord(']'): '7',
    ord('\n'): '',
})

print(bf)
print(int(num, 8))
\$\endgroup\$
0
7
\$\begingroup\$

67. Plain TeX, uses no z

^^5clet~^^5crelax
^^5cedef^^5cPARSEo^^7b~^^5cmeaning^v^^7d
^^5cdef^^5cPARSEii#1#2v^^7b^^5cdef^^5c1^^7b#1^^7d^^7d
^^5cdef~#1#2^^7b^^5cdef^^5c2^^7b#1^^7d^^5cPARSEii^^7d
^^5cPARSEo
^^5cwrite1^^7b^^22Mother^^Iof^^Imerc^^79^^2c^^Ii^^5c2^^Ithi^^5c2^^Ithe^^Iend^^Iof^^IRico?^^22^^I^^2d^^ICe^^5c2are^^IEnrico^^I^^22Rico^^22^^IBandello^^7d
``Mother^^Iof^^Imerc^^79^^2c^^Ii^^5c2^^Ithi^^5c2^^Ithe^^Iend^^Iof^^IRico?^^22^^I^^2d^^2d^^2d^^ICe^^5c2are^^IEnrico^^I``Rico^^22^^IBandello
^^5cb^^79e

Output is quote 73:

"Mother of mercy, is this the end of Rico?" - Cesare Enrico "Rico" Bandello

Previously forbidden: py3\" ';({s[)<+.@=-,X0*/&]>

I both \write the text to the console (and the log file), and typeset it.

TeX allows any character to be represented with ^^ followed by a hexadecimal code. This replacement is performed before lexical analysis. This allows most forbidden characters to be bypassed, but not those whose hexadecimal representation requires the forbidden digits 0 or 3, so some other solution is needed for p and s (p turned out not to be needed for this quote). I extract them from the meaning of ^. Here's the program with hexadecimal escapes replaced (and ^^I, which TeX parses as a tab which is equivalent to a space).

\let~\relax
\edef\PARSEo{~\meaning^v}
\def\PARSEii#1#2v{\def\1{#1}}
\def~#1#2{\def\2{#1}\PARSEii}
\PARSEo
\write1{"Mother of mercy, i\2 thi\2 the end of Rico?" - Ce\2are Enrico "Rico" Bandello}
``Mother of mercy, i\2 thi\2 the end of Rico?" --- Ce\2are Enrico ``Rico" Bandello
\bye

I'd be curious to see a LaTeX solution.

\$\endgroup\$
3
  • 1
    \$\begingroup\$ LaTeX without { or \ seems difficult; then again, I don't know much high-level (or is it low-level?) LaTeX... \$\endgroup\$ Oct 30 '14 at 2:28
  • \$\begingroup\$ @archaephyrryx \ has been forbidden for a very long time. That's not a problem thanks to ^^. The real difficulty is actually the lack of s! \$\endgroup\$ Oct 30 '14 at 2:32
  • \$\begingroup\$ Just realized that we should have made a program out of the sequence of forbidden characters, perhaps something like this or this \$\endgroup\$
    – justhalf
    Oct 30 '14 at 3:05
7
\$\begingroup\$

49. l33t (uses no :)

(Uses 55 newlines)

I`C222
D84D`P888Pll22Z!
in`Y44r
Drim2Z?
wH4il2
YOu2Z
aw8K?
D2aD
PPl5
li4K5
iN`6raVZ?
iN`cOffiN52Z?
w4lKin62`4r8unD5
li4K
r5GuLaR
P222Pl!
tH42Y
DOn`5t
C22
64cH
O4tHr!
tH88Y`9nlY`C666
wHAt2Z
tH8888Y`w4n9t`2`C222!`th8888Y
D888nt`Kn999w`th88Y`4r
D8884D!`H99w`9ft8n`D8
Y2u
C88`tH8888m?`4ll`t666H
Ti444m!`th8888Y`4r`8V8rYwH52r!

Y9u`Kn999w`t8H`a66iD65nt
uP`tH8888r?`Y5588h?`SOm6On6
gOt2Z
H664rt!`tH8888Y`D88D?`4`L4DY!`5H5
Di58D!`OM6!`wH4444t`c444n`Y8u`C88
H6r?`Y88885!`wH4888rZ5`i5
5H6?`5t4nDiN9999`N88%t`2`m44i
w88n6OW55!`cOl666`Y888u`4r
5c4Rin99`m66!`tH8888Y
Sc4r66
Mi4
2
5OmTim55!
tH2Y?
6H885t55!

Y99u`6V6r`f9888L`t666H
Pr8Kl5Y`tH8888nG5`8n`t6H`68cK
8f`Y99999r`n666cK?
Y2S!
4nD`t66h`T888nY`h44iR5
8n`Y8888r`4Rm`Y9u`Kn99w
wH888n`tH8888Y`5t4nD2
u9?`tH8888t5`tH688m!`wH88n
tH888Y`86tZ`m4D`iT`86tZ`cOlD!```5tOP9`l88Kin9`4t`m6!`i`D8888N`t`l44iK`P888Pl`L88Kin9`4t`m6`l44iK`tH888t
!!!

Output is quote 44:

"I see dead people." - Cole Sear

Previously forbidden: "#&'()*+,-./0137;<=>@[\]^_ deEhopQksvxXyz{|}~

Remaining characters:

  • Symbols: ! $ % ? `
  • Numbers: 2 456 89
  • Uppercase: ABCD FGHIJKLMNOP RSTUVW YZ
  • Lowercase: abc fg ij lmn qr tu w

You can run it with a C or Perl interpreter.


l33t is a BF-like language with the following features:

  • Opcodes are numbers 0-10 obtained by summing the digits in each word of the input; all non-digits are ignored but the programmer will be considered "teh sUxX0r" if they're left out.
  • Increment, decrement, and pointer move instructions take an argument.
  • Code and data share the same memory space, allowing for self-modifying code. This was used since some opcodes (1 and 3 for output and 'if') could not be coded directly due to character restrictions.

"Disassembly" of the program:

; Patch WRT (opcode 1)
BAK 40(+1)
DEC 2(+1)
; Patch IF (opcode 3)
BAK 2(+1)
DEC 2(+1)
; Move mem ptr to start of string
FWD 9(+1)
IF
  ; Output each char; stored as ASCII-30 (mod 256)
  INC 29(+1)
  WRT
  FWD 6(+1)
  BAK 5(+1)
EIF
END
; String starts here...
\$\endgroup\$
1
  • \$\begingroup\$ This is really great! \$\endgroup\$
    – Paul
    Jul 29 '16 at 19:11
7
\$\begingroup\$

42. Beatnik (uses no $)

(Newlines are only for poetic effect)

Man`Fail`but`will`Summit`

man`attain`but`attract`
man`bill`but`flaunt`
man`call`but`attract`
man`aim`but`act`
man`fan`but`inflict`
man`quit`but`jab`
man`calm`but`jam`
man`quit`but`climb`
man`mimic`but`inflict`
man`affirm`but`climb`
man`cram`but`jab`
man`quit`but`maim`
man`cut`but`bar`
man`quit`but`mimic`
man`affirm`but`jam`
man`affirm`but`inflict`
man`maul`but`jab`
man`calm`but`quit`
man`jam`but`flaunt`
man`ram`but`nab`
man`cram`but`trim`
man`taunt`but`rub`
man`built`but`train`
man`attract`but`win`
man`flaunt`but`quit`
man`inflict`but`climb`
man`affirm`but`mimic`
man`act`but`jab`
man`fall`but`quit`
man`affirm`but`climb`
man`aim`but`quit`
man`cut`but`bar`
man`maim`but`quit`
man`jam`but`nab`
man`affirm`but`quit`
man`quit`but`mimic`
man`affirm`but`inflict`
man`mimic`but`climb`
man`affirm`but`jab`
man`quit`but`jam`
man`rub`but`ram`
man`fill`but`attain`
man`climb`but`inflict`
man`mimic`but`jab`
man`affirm`but`climb`
man`maintain`but`crawl`
man`flit`but`taunt`

FIGHT!`LASH!
ATTACK!`THRASH!
ASSAULT!`MARCH!
GUARD!`SLAY!`FAST!
Man`AVIDLY`Can`CLASH!
FAST`LURCH!`Panic!
PATCH!`DISPATCH!`CRAZY!

MOST`DIPLOMATIC?

Output is quote 48:

"Well, nobody's perfect." - Osgood Fielding III

Previously forbidden: "#&'()*+,-./01357:;<=>@[\]^_ BdeEghJNopQksvWxXyz{|}~

Remaining characters:

  • Symbols: ! % ? `
  • Numbers: 2 46 89
  • Uppercase: A CD FGHI KLM OP RSTUV YZ
  • Lowercase: abc f ij lmn qr tu w

You can run it with this Perl interpreter. Some other interpreters may not work correctly since they explicitly look for whitespace, even though the spec says that words may be "separated by any sort of punctuation."


Beatnik is a stack-based language whose operations are determined by the Scrabble score of each word. For instance, "man" scores 5 points, and the corresponding operation pushes the score of the next word onto the stack.

  • The title of the poem generates a 0 on the stack so the display loop knows when to end.
  • The first verse pushes the characters on in reverse order. Each character is represented by 2 values in the range of 5-14.
  • The second verse is the display loop. Each character is generated from its values by ASCII = 32 + (top_value-5)*10 + (bottom_value-5) and is output.
  • The final line empties the stack and ends the program.
\$\endgroup\$
6
\$\begingroup\$

94. JavaScript, uses no p

document.write('"I\'ll get you, my &#112;retty, and your little dog, too!" - Wicked Witch of the West');

Output is quote 99. (Run the snippet.)

Previously forbidden: none

\$\endgroup\$
6
\$\begingroup\$

88. CJam, uses no '

24A+77_;121S112_))101_((105_;111_;117_((46_;24A+S45S71_;111_(((_117_;109]:c

Output is quote 85:

"My precious." - Gollum

Previously forbidden: py3\"<space>

\$\endgroup\$
6
\$\begingroup\$

70. Gibberish (uses no &)

(Newlines are for clarification only. They are not necessary.)

e
289amgteq
725mmgteq
7867amagteq
6991aamgteq
4956amagteq
2956amagteq
4147mamgteq
48mgteq
5145mamgteq
4147mamgteq
456amgteq
48mgteq
289magteq
8899maagteq
8956amagteq
2956amagteq
456amgteq
48mgteq
5145mamgteq
4147mamgteq
956magteq
5744mamgteq
48mgteq
479magteq
867amgteq
5145mamgteq
2556ammgteq
8899maagteq
4147mamgteq
7867amagteq
789amgteq
2556ammgteq
159magteq
289amgteq
48mgteq
59mgteq
48mgteq
489magteq
8899maagteq
789amgteq
6991aamgteq
2956amagteq
2556ammgteq
956amgteq
2956amagteq
48mgteq
699magteq
8899maagteq
269mmgteq
5744mamgteq
867amgteq

Output is quote 74.

"Forget it, Jake, it's Chinatown." - Lawrence Walsh

Previously forbidden: py3\" ';({s[)<+.@=-,X0*/

The interpretor on http://esolangs.org/wiki/User:Marinus/Gibberish_interpreter is used to verify the result.


Gibberish is a stack machine. Every digit 0–9 pushes that number onto the stack, m is multiplication, a is addition (e.g. 289am means (9+8)×2 = 34), and gteq pops a number and prints the corresponding ASCII character. So every line in the program prints a single character of the quote.

\$\endgroup\$
6
\$\begingroup\$

44. Dupdog mod 257 (uses no g)

There are 13,141 characters in the source code, it consists only of the characters a and ?:

a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????a???????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a???????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????a??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

or as this base64-encoded zlib-compressed data:

eJzt2LENxDAMQ9HRMov3XyJVuhQ2YJuU+N8CJiUFONx4Mgx1AITKvbw6zeskXaVupn5/VpWcq7r2
Anbr/q107+dOP399Ap3k7pinuxMutD92nI3918CeTmK6ORx+T93KwF37Yje52P1dSfNO6vpPPQH1
+3NqpOyJ2X9SJ5Ha2412Dydfr3BhDhk9LsBhEvdltgaS1PjKHf4Xzk2Ag14Edqi8

The SHA-1 sum should be 5f4eb39aa6c8d5d904d0dfc8c7f20619c8099874. There shouldn't be any trailing new lines.

Output is quote 54:

"There's no crying in baseball!" - Jimmy Dugan

Previously forbidden: "#&'()*+,-./01357:;<=>@[\]^_ BdeEhJopQksvWxXyz{|}~

Remaining characters:

  • Symbols: ! $ % ? `
  • Numbers: 2 46 89
  • Uppercase: A CD FGHI KLMNOP RSTUV YZ
  • Lowercase: abc f ij lmn qr tu w

Dupdog is a thing that looks like a self-modifying language. It works like this:

  1. Read the first character from the code string, and then feed it to the mfit interpreter:

    • If the character is ~, duplicate the source code
    • Else if the character is ?, and the length of the source code is odd, do nothing. Otherwise, rotate the characters ?!~?.
    • Otherwise, print out the length of the source code mod 257 as an ASCII character. The modulus is customizable but I follow the example from esolang which is 257.
  2. Remove that character from the code string.

  3. Read the first character from the remaining code string, and then feed it to the shanty interpreter:

    • If the character if !, duplicate the source code.
    • Else if the character is ?, reverse the source code.
    • Otherwise, print out the length of the source code as an integer, then stop the program.
  4. Remove that character from the code string.

  5. Repeat from step 1.

There is a Hello world example from esolang, which one could easily see the pattern:

  • print character
  • series of rev;nop;rev;nop;... to pad the code length.
  • print character
  • ...

So here is a highly inefficient compiler to generate the dupdog source code above:

def compile_quote(quote):
    # Determine the positions where the character needs to be printed.
    lengths = []
    for c in reversed(quote):
        code = ord(c)
        if lengths:
            delta = (code - lengths[-1]) % 257
            if delta == 0:
                delta = 257

            code = delta + lengths[-1]
            if code % 2 == 0:
                code += 257
        else:
            if code % 2 == 0:
                code += 257
        lengths.append(code)

    print(lengths)

    # Build up the source code.
    final_code = ''
    for length in lengths:
        while len(final_code) < length-1:
            if len(final_code) % 2 == 1:
                final_code = '?' + final_code[::-1]
            else:
                final_code = '?' + final_code
        final_code = 'a' + final_code

    return final_code
\$\endgroup\$
4
  • 3
    \$\begingroup\$ There are so many crazy languages I've never heard of being showcased here. Awesome. \$\endgroup\$
    – Claudiu
    Nov 17 '14 at 21:54
  • 1
    \$\begingroup\$ I wonder if there are any non-esoteric languages left that can compete in the challenge at this point. \$\endgroup\$ Nov 18 '14 at 6:35
  • \$\begingroup\$ @gone_native I highly doubt it. The banning of ( is pretty fatal for non-esoteric languages. Even esoteric languages are hard to find these days. \$\endgroup\$
    – kennytm
    Nov 18 '14 at 8:48
  • \$\begingroup\$ If there's ever a chance, I'm guessing either some BASIC variant or other old-school imperative language, or another "machine code in ASCII" like the 80386 answer. I looked into 8051 until I found the code memory isn't modifiable. \$\endgroup\$ Nov 19 '14 at 5:16
6
\$\begingroup\$

11. BSM (uses no r)

It begins with:

9taKSlS48SlS48SlS48SlS48SlS48SlS48SlS48SlS48SlS48SlS48SlS48SlS48S...

and ends with:

...atwK4cacla9taKSlS48SlS48SlS48SlS48SlS48SlS48SlS48SlS48449SatwK4aa

bzip2 base64:

QlpoOTFBWSZTWdZ9lFcAFjZPgAAQBGAACAgAKAQEgDABWUiCT1VQwmEA000BSVTCaad8SHciUnMh
3IZJVJzLrVL2Q0h+kSk8kPKFt0q1ttFMSNisVJqqIbKI2KVmJbSm1stlErYg22olsBbS2UbLa20W
xtrRbFajQQVo1Y1otaLYxaqNGSioxsUWNaGaNqBmkzWyznkh7IeekPZD4Q6IfJEpOCHkhxIdSH8X
ckU4UJDWfZRX

Or see it here: http://pastebin.com/G15g57P4

Output is quote 7:

"All right, Mr. DeMille, I'm ready for my close-up." - Norma Desmond

Previously forbidden:

?!"#$%&'()*+,-./0123567:;<=>@[\]^_` AbBCdDeEFfgGhHiIjJkLmMNoOpPqQRsTuUvVWxXyYzZ{|}~

Remaining characters:

  • Numbers: 4 8 9
  • Uppercase: K S
  • Lowercase: a c l n t w

I gave up working on VTL. I think it should be possible in VTL. But it is not easy to golf the program into 256 bytes... And it should be a bad idea using esoteric binary languages. There should be much more useful instructions in a real machine code...

Explanations later. I wrote a program to search for solutions. And it generated this code with the SlS48 pattern.

Now I have 3 usable languages left, including one for answer 1 and one for answer 2. And the 3rd one won't be likely unusable soon. I'm not sure I should post them. I have a 4th one which can print the quote, but will exit with an error. I'm not sure I can use it...

\$\endgroup\$
7
  • \$\begingroup\$ I don't understand what the code is. The answer specifies only the beginning and the end, and omits the middle. Is there any kind of repeating pattern in the middle? If yes, what is it, and how many times is it repeated? If not, maybe you should describe how the code can be generated. (I see that this answer was upvoted; did I miss something?) \$\endgroup\$
    – anatolyg
    Dec 7 '14 at 10:46
  • \$\begingroup\$ @anatolyg It was in the base64 encoded bzip2 file. Now I added a pastebin link. \$\endgroup\$
    – jimmy23013
    Dec 7 '14 at 10:55
  • \$\begingroup\$ If it weren't for an interpreter bug, I'd finally have a VTL solution now. :( \$\endgroup\$ Dec 10 '14 at 5:59
  • \$\begingroup\$ @gone_native What's the bug then? \$\endgroup\$
    – jimmy23013
    Dec 17 '14 at 17:30
  • 1
    \$\begingroup\$ @gone_native Just to be clear - did you disassemble the VTL interpreter to discover what it does? \$\endgroup\$
    – anatolyg
    Dec 29 '14 at 21:02
6
\$\begingroup\$

13. Villmark (uses no u)

caDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDr8caDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDr8caDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDanDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDr8cDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDan

Output is quote 10:

"You talking to me?" - Travis Bickle

Previously forbidden:

?!"#$%&'()*+,-./0123567:;<=>@[\]^_` AbBCdeEFfgGhHiIjJkLmMNoOpPqQRsTUvVWxXyYzZ{|}~

Remaining characters:

  • Numbers: 4 8 9
  • Uppercase: D K S
  • Lowercase: a c l n r t w

I don't know how it works exactly... and there is no easy way to debug this code.

caDDD....an or cDDD...an outputs the character 2*number of Ds + number of as, assuming the current, previous and next cell are all zero at the beginning.

After output, the three cells will be messed up which I don't know how to fix using the available characters. Instead I just changed the memory position (and cleared them) using r8. Villmark has only 256 bytes of memory so I tried to move as short as possible.

The current memory cell after output will be the outputed character if there were one a, or the character negated if there were two (I guessed). Each D will decrease it by 4. I decreased it a few times so it will be a number from 1 to 4 (or from -255 to -252) before r8. But I don't really know how many times the current cell value the pointer will move.

Repeat the caDDD....anDDD...r8 to output other characters.

I didn't get those numbers right after rereading the documentation a few times. So I just tested and saw what has happened.

Generator (in CJam)

It works for shorter strings. But it need some workaround (by removing some Ds) to print this quote.

q{'c\i_(2md_'a*@'D*@{@255\-}{@(}?4/'D*"an"\"r8"}/
\$\endgroup\$
3
  • \$\begingroup\$ How does the generator work (I don't understand CJam)? \$\endgroup\$
    – anatolyg
    Dec 2 '14 at 8:45
  • \$\begingroup\$ @anatolyg Added some explanation. \$\endgroup\$
    – jimmy23013
    Dec 2 '14 at 9:33
  • \$\begingroup\$ Ashtol looks like a good language for this challenge. But now it is too late for that... \$\endgroup\$
    – jimmy23013
    Dec 2 '14 at 17:08
5
\$\begingroup\$

92. C++, uses no 3

#include <iostream>
int main(void){
    std::cout << "\"M\x79 mother thanks \x79ou. M\x79 father thanks \x79ou. M\x79 sister thanks \x79ou. And I thank \x79ou.\" - George M. Cohan" << std::endl;
    return 0;
}

Output is quote 97:

"My mother thanks you. My father thanks you. My sister thanks you. And I thank you." - George M. Cohan

Previously forbidden: py

\$\endgroup\$
8
  • 1
    \$\begingroup\$ Remove return 0; and void for me please. It makes me uncomfortable. \$\endgroup\$
    – nwp
    Oct 30 '14 at 22:39
  • \$\begingroup\$ @nwp although the void is redundant in C++, I like to write it nevertheless, to make the program more C-compliant, so it's a matter of taste, I guess. What's wrong with returning 0 though? \$\endgroup\$
    – Flonk
    Oct 30 '14 at 22:56
  • 1
    \$\begingroup\$ return 0; from main has no meaning just like the void. It technically does not matter, but somehow meaningless code bothers me. \$\endgroup\$
    – nwp
    Oct 30 '14 at 23:17
  • 1
    \$\begingroup\$ @nwp We may be able to argue about the void, but return 0; is actually important if you want to write sandards-compliant code! main is of type int, so that's what you should be returning; 0 generally being used to indicate a successful computation. The only reason you can omit return 0; inside main is because your compiler is being nice and does it for you :) \$\endgroup\$
    – Flonk
    Oct 30 '14 at 23:38
  • 1
    \$\begingroup\$ Actually the reason you can omit return 0; in main is because the C++ standard says so in § 3.6.1.5: If control reaches the end of main without encountering a return statement, the effect is that of executing return 0; \$\endgroup\$
    – nwp
    Oct 30 '14 at 23:46
5
\$\begingroup\$

83. ABC (uses no [)

$aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaacbbbbbbbbcbbbbbbcbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcbcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaacbbbbbbbbcbbbbbbcbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcacbbcaaaaaaaaaaaaacbbbbbbbbbbbbbcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacbbbbbbbcaaaaaacbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaacbcbbbbbcbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcbbcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaacbcbbbbbbbbbbbbbbbbbbbcaaaaaaaaaaaaaaaaacacbbbbbbbbcaaaaaaaaaaaaaac

Output is quote 82:

"Toga! Toga!" - John "Bluto" Blutarsky

Previously forbidden: py3\" ';({s

Sadly, all implementations at esolangs wiki's ABC page are not available. But I used 4chan's Scheme implementation (#59 at link) to confirm.

You can test this code by pasting below code into Scheme REPL:

(define (abc source)
  (define accumulator 0)
  (define ascii #f)
  (define (interpret i)
    (cond ((char-ci=? i #\a) (set! accumulator (+ 1 accumulator)))
          ((char-ci=? i #\b) (set! accumulator (- 1 accumulator)))
          ((char-ci=? i #\c) (display (if (eq? #t ascii) 
                                          (integer->char accumulator) 
                                          accumulator)))
          ((char-ci=? i #\d) (set! accumulator (* (- 1) accumulator)))
          ((char-ci=? i #\r) (set! accumulator (random accumulator)))
          ((char-ci=? i #\n) (set! accumulator 0))
          ((char-ci=? i #\$) (set! ascii (not ascii)))
          ((char-ci=? i #\l) (run))
          ((char-ci=? i #\;) (display accumulator)
                             (display (integer->char accumulator)))))
  (define (run)
    (for-each interpret (string->list source))
    (newline))
  (run))

and run:

(abc "$aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaacbbbbbbbbcbbbbbbcbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcbcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaacbbbbbbbbcbbbbbbcbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcacbbcaaaaaaaaaaaaacbbbbbbbbbbbbbcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacbbbbbbbcaaaaaacbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaacbcbbbbbcbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcbbcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaacbcbbbbbbbbbbbbbbbbbbbcaaaaaaaaaaaaaaaaacacbbbbbbbbcaaaaaaaaaaaaaac")
\$\endgroup\$
5
\$\begingroup\$

77. J, uses no =

u:77-/~111,155,188,109,196,182,191,178,109,181,174,187,180,178,191,192,121,109,178,195,178,191,110,111,109,122,109,151,188,174,187,109,144,191,174,196,179,188,191,177

Output is quote 72:

"No wire hangers, ever!" - Joan Crawford

Previously forbidden: py3\" ';({s[)<+.@

\$\endgroup\$
5
\$\begingroup\$

86. Unary, uses no (

The program is just zeroes, where there are

3370971879267571102231643973781960767867550138500652727650351697850864913411545006931190734691180553937006013507681275962201778225289692044082143520288261965332265972154319968050788756511250725103270946807157425544153602650433669066963868896995130901490782639979913121839366119236608463113517743139855522117600450690578894187500712399026355375661695529787727754868007581380838269928497117227554954220591057529108858620184618835905762023825471169929147497610275266918823110420309701824429054183904188114619210248612265864818110705898215160364915125191320132175721938926287431875255258020269868850949033884281079645023697188921092389981998559383107732

of them.

Output is quote 86:

"Attica! Attica!" - Sonny Wortzik

Previously forbidden: py3\" ';

Corresponding BF:

++++++++++++++++++++++++++++++++++.+++++++++++++++++++++++++++++++.+++++++++++++++++++++++++++++++++++++++++++++++++++..-----------.------.--.----------------------------------------------------------------.-.+++++++++++++++++++++++++++++++++.+++++++++++++++++++++++++++++++++++++++++++++++++++..-----------.------.--.----------------------------------------------------------------.+.--.+++++++++++++.-------------.+++++++++++++++++++++++++++++++++++++++++++++++++++.++++++++++++++++++++++++++++.-..+++++++++++.-----------------------------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++.++++++++++++++++++++++++.+++.++.++++++.-----------------.++.
\$\endgroup\$
4
  • 1
    \$\begingroup\$ You can't use quote 9 \$\endgroup\$
    – Michael M.
    Oct 29 '14 at 9:25
  • \$\begingroup\$ @Mig Sorry, I seem to have missed the part in the spec concerning that. Is it good now? \$\endgroup\$
    – Sp3000
    Oct 29 '14 at 9:29
  • 1
    \$\begingroup\$ That paren is killing me! Now I have to deal with 3 in my hex strings! \$\endgroup\$ Oct 29 '14 at 9:49
  • 2
    \$\begingroup\$ I would say that's a big number. \$\endgroup\$
    – seequ
    Nov 12 '14 at 14:07
5
\$\begingroup\$

53. evil (no 1)

Whitespace unnecessary.

aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaawaaaaaaaaaawaaaaaaaawaaaaaaaaaaawuuuuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawuuuu
waaaaawaaaaaaawuwuuuuuuuuuuuuuuuwuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuwuuuuuuuuuuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawuuuuuuuuuuuuuuuuuu
uuuuwaaaaaaaawaaaaaaaaaaawuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawuuuuwaaaaawaaaaaaawuwuuuuuuuu
uuuuuuuwuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwuuuuuu
uuuuuuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawaaa
aaaaaaaaaaaaaaaaaaawaaaaaawuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawaaaaaaaawaaaaawuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuuuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaawuuuwuuuuwaaaaaaaaaaaaaaaaawuuuuuuuuuuuuuuwuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawawaaaaaw
uuuuuuuuuuuuwawaaaaawuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuwuuuuuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawuuuuuuuuuuuuuuuuuuu
uwaaaaaaaaaaaaaaawuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuwawuuwaaaaaaaaaaaaawuuuuuuuuuuuuuwaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawaaaaaaaaaaaaaaaaaaaaaaawaaaaaaaa
aawuuwuuuuwuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuuuuuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawaaaaaaaa
aaaaaaawawaaaaaaawaaaaawawaaaaaaaawuuuuuuuuuuuuuuwaaaaaaaaaaawaaaaaawu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaawaaaaaaaaaaaaaaaaaaaaaaawaawaaaaaaaawu
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
uuuuwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaawaaaaaaaaaaaaaa
aaaaaaaaaaaaaaawuuuuuuuuuuuuuwaaaaaaawaaaaaw

Output is quote 67 "Of all the gin joints in all the towns in all the world, she walks into mine." - Rick Blaine

Remaining characters:

  • Symbols: ! $ % : ? `
  • Numbers: 2 456 89
  • Uppercase: ABCDEFGHIJKLMNOP RSTUVW YZ
  • Lowercase: abc fghijklmn qr tu w
\$\endgroup\$
1
  • \$\begingroup\$ Surely you could golf that down further. ;) \$\endgroup\$
    – DLosc
    Nov 8 '14 at 19:32
5
\$\begingroup\$

18. ferNANDo (Uses no 2)

w w
D
l
u D
c u u
H l i
r n n
S u n
K S S
t n H
f t t
H H
O O
a f w a a f O f
a t n H c S c r
a K w a u r S a
a u n r K u K K
a K w a w w t f
O n
n D
i i
l i
l
D D
D

(58 tabs, 24 newlines)

Output is quote 15:

"E.T. phone home." - E.T.

Previously forbidden:

?!"#$%&'()*+,-./013567:;<=>@[\]^_` AbBCdeEFgGhIjJkLmMNopPqQRsTUvVWxXyYzZ{|}~

Remaining characters:

  • Symbols: none
  • Numbers: 4 8 9
  • Uppercase: D H K O S
  • Lowercase: a c f i l n r t u w

An interpreter written in Python can be found at the link in the title.


ferNANDo is an esoteric language that only supports one variable type, boolean, and only one operator, NAND. The above program loops 5 times, printing a different 5 characters every time. Each of the 'print statements' (lines with 8 variables) encode for 5 bytes of output. Not quite as trivial as it might sound, although the hardest part was reducing the number of necessary tabs below 64.

\$\endgroup\$
2
  • 1
    \$\begingroup\$ I think you could still do it with only one unique character. And this was another candidate for answer 1. But it was surprising knowing ferNANDo works in this challenge, with only 64 tabs. \$\endgroup\$
    – jimmy23013
    Nov 29 '14 at 9:39
  • \$\begingroup\$ @user23013 ahh yes, using the variables a, aa, aaa, etc. The tab restriction is fairly hard, though. Any output longer than ~30 bytes would be nigh impossible. \$\endgroup\$
    – primo
    Nov 29 '14 at 9:51
5
\$\begingroup\$

80. DNA#, uses no +

ATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAGCATATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAGCATATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAGCATATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATGCATGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAGCATATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAGCATATCGATCGATCGATCGATCGATCGATCGATCGGCATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGCATATTAATTAGCATATTAATTAATTAATTAATTAATTAATTAATTAGCAT

Output is quote 79:

Striker: "Surely you can't be serious." Rumack: "I am serious...and don't call me Shirley." - Ted Striker and Dr. Rumack

Previously forbidden: py3\" ';({s[)<

Corresponding BF:

+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++++++++++++++++++++++++.--.---------.++.------.+++++++++++++.--------------------------------------------------------.--------------------------.++.+++++++++++++++++++++++++++++++++++++++++++++++++.++++++++++++++++++++++++++++++++++.---.-------------.+++++++.+++++++++++++.-----------------------------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.----------.++++++.-------------------------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.--.+++++++++++++.-----------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.------------------------------------------------------------------------------------.++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.+++.---------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.--------------.+++++++++++++.---------.++++++.++++++.--.---------------------------------------------------------------------.------------.--.++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++++++++++++++++++++++++++.--------.------------.++.++++++++.-------------------------------------------------.--------------------------.++.+++++++++++++++++++++++++++++++++++++++.-----------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.++++++++++++.-----------------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.--------------.+++++++++++++.---------.++++++.++++++.--.---------------------------------------------------------------------...+++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++++.----------.--------------------------------------------------------------------.++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++.-.-----------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.------------------------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.--.+++++++++++..----------------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.--------.---------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++++++++++++.+.+++++++++.------.-------.++++++++++++++++++++.---------------------------------------------------------------------------.------------.--.+++++++++++++.-------------.++++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++++++++.-.--------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++++++++++++++++++++++++.--.---------.++.------.+++++++++++++.----------------------------------------------------------------------------------.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++++.----------.--------------------------------------------------------------------.++++++++++++++++++++++++++++++++++++.++++++++++++++++++++++++++++++++++++++++++++++.--------------------------------------------------------------------.--------------.++++++++++++++++++++++++++++++++++++++++++++++++++.+++++++++++++++++++++++++++++++++++.--------.------------.++.++++++++.

...and that rules out half the BF derivatives. (Edit: Actually it doesn't - in hindsight I should have picked .)

\$\endgroup\$
4
  • 1
    \$\begingroup\$ Where'd you get the interpreter for this? I've looked previously but couldn't find one... \$\endgroup\$
    – Beta Decay
    Oct 29 '14 at 13:09
  • 1
    \$\begingroup\$ @BetaDecay There's one at the bottom of the esolang page, but it doesn't seem to work for me. In any case, I've only used 3 BF symbols, and since the BF worked and DNA-sharp is just a symbol substitution for those, I figured it'd be okay. \$\endgroup\$
    – Sp3000
    Oct 29 '14 at 19:29
  • \$\begingroup\$ @Sp3000 The actual name of the language is DNA#. The title of this article is incorrect because of technical limitations. The correct title is DNA#. \$\endgroup\$
    – mbomb007
    Apr 25 '16 at 16:40
  • \$\begingroup\$ @mbomb007 Edited \$\endgroup\$
    – Sp3000
    Apr 25 '16 at 16:59
5
\$\begingroup\$

4. 1L_a105 (uses no S)

Bzip2 base64:

QlpoOTFBWSZTWVR7yccAMKPJBP/zgEAIACQAAAhgCh8fX2ZMFsFCgAyUUDWIqtBVMUyYmQZGFMmJ
kGRhTJiZBkYJPVKSjTJpoAmpSKaTyJoeoFJSEoYCH2Cn2qmEpqUGFZEmVWiDRKsJGUrUDVFMgbKL
CqwL+5JIu+pxDaUCrUXmU0oPSp6qLhIexTKrr4zYzWxrZGTS+euNkqJSShWg2azbLpEXIMKVe6jf
m/CPNKuVCeiNRYjviqXpWqY1lqlsDohjlDUXFKwV1xVcqulOaOFOBHAsF1oHz3xFkpMRhStqqL6i
MonEjzEcJXKJsWUoplMAl9+42TRsgtGaWiEz8WiEis2aWGKmxMVGWCpd10Tdtbdq4pIhkxRpqitU
1BFHXNGjQqmkJba1q2zWbbJGKZEtEaDwxprYYxjU2pfOHLaUSFImoDSqWgk15WqNbXtrlGkaSZMS
mpIu6YhNSaNV3bNN27a7LN1IbRr79KVGhiU0jaSmjNM2kzNqJLMNrM2jNNocqvKlgchTzXpAUoka
iUwhkRohkrW3attLXZgaMxK03gSZGyJFCUiJAoGRIsJUMTbW3s1pXBZaqNJ6YY2xMmtbZvGBLKaI
2RIsUzrbZuiJBK0sMxIkWiMTBmpKTDAeeUkoxBEbKZhSjJMkjbWyq9tfLFGAiik2maUEurbxBkwp
IWhNKolo0Xa8YxbKUWTIWbDUGJKNFJc+mGkySizUEbzzIRa9aYtcJ1Lmk2EmQZXZRSljbz1Ms2SI
WQ2kRs0FbVuSOkAZ371yi7J6jRicklfERiHIOSnDzms1DDMCYTKUiJo0sEBMW5bVqVqm2qy1TUVo
pfXEi5UmQbQ+/tbTDEQUikV9EkyTFKE6Hzgq7BcxpkEurjRiteeZTYiCMUkp6SPGRHj0fvLZa21t
a2rLMpEN5W1srckhhgC0JTEBBTUtg1IETdfGt8KGaMRagbMWZoI0MpO2tmuxmU2kMaMmMUa6229k
ssNRAsFkrDNAwlqbEiFGtsQ0mRZE893rW2GbZZImBQJESkKJEzazWtts6lHzCrahNoFfrkpwh4iO
EcUtKNVLrlEcEyR8QaVfBeLNNta1YyxMSM02Cy+HSlMUUR9tWttq9CWWRERmjAIhixDExUTMLbWw
VYjBYFWtrbWtqTLbDUFkiRFra021mgD3e/D3uYutuua6uVuq3xpa7uuzXb1pel3XJIulSQVzBous
Q9op3Tyd8PN3K3XTuOObd5ZnePHjq5o0afbbVX519NoSm+bM2u3btNnarmk1IRk82tavLxJqUjJk
miaKNdbbV9eGZtK0KVPeugyCaKSmLGCSkkQnVVK70le8ejNmYzZsy2oYlGmxm0u2ZotF3NLoxtrb
NWxQ+SGKZFlNXxL3kTlzZczLtzq1Tp1Bw5pzuXVy5CuJBdyuqg/4u5IpwoSCo95OOA==

Or see it here: http://pastebin.com/083XbrLW

Note that the trailing newline is required.

This image does the same thing: http://i.stack.imgur.com/pdWDE.png

And to demonstrate, this program outputs "Love means:

c8888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888c8
c8cc888ccc88888ccc888888888888888888ccc888888888888888888ccc88888ccc888888888888888888ccc888888888888888888ccccccccccc88888cccc88ccc88888ccc888888888888888888ccc88888ccc888888888888cccc88ccc88888ccc88888888888888888ccccccccccc8888888888ccc8888888888888888888ccc88888ccc88888888888888888ccc88888ccc888888888888cccc88ccccccccccc8888888888ccc88888ccc888888888888cccc88ccccccccccc8888888888ccc888888888888888888ccccccccccc8888888888ccc888888888888888888ccccccccccc88888cccc88ccccccccccc88888cccc88ccc88888ccc888888888888888888ccc888888888888888888ccc88888ccc88888888888888888ccc88888ccc88888888888888888ccccccccccc8888888888ccc8888888888888888888ccc88888ccc888888888888cccc88ccccccccccc88888cccc88ccccccccccc8888888888ccc888888888888888888ccccccccccc88888cccc88ccccccccccc88888cccc88ccccccccccc8888888888ccc888888888888888888ccc88888ccc88888888888888888ccccccccccc88888cccc88ccccccccccc8888888888ccc8888888888888888888ccc88888ccc88888888888888888ccc888888888888888888ccccccccccc8888888888ccc88888ccc888888888888cccc88ccc88888ccc888888888888888888ccc88888ccc88888888c8
c8cccc8c8c88888c8c888888888888cccc88c8c88888888888888ccc8c8c88888c8c888888888888cccc88c8c88888888888888ccc8cccc888888c88888c88c88c8c88888c8c888888888888cccc88c8c88888c8c888888888888c88c88c8c88888c8c8888888888888ccc8cccc888888c888888ccc8c8c8888888888888cccc88c8c88888c8c8888888888888ccc8c8c88888c8c888888888888c88c88cccc888888c888888ccc8c8c88888c8c888888888888c88c88cccc888888c888888ccc8c8c88888888888888ccc8cccc888888c888888ccc8c8c88888888888888ccc8cccc888888c88888c88c88cccc888888c88888c88c88c8c88888c8c888888888888cccc88c8c88888888888888ccc8c8c88888c8c8888888888888ccc8c8c88888c8c8888888888888ccc8cccc888888c888888ccc8c8c8888888888888cccc88c8c88888c8c888888888888c88c88cccc888888c88888c88c88cccc888888c888888ccc8c8c88888888888888ccc8cccc888888c88888c88c88cccc888888c88888c88c88cccc888888c888888ccc8c8c88888888888888ccc8c8c88888c8c8888888888888ccc8cccc888888c88888c88c88cccc888888c888888ccc8c8c8888888888888cccc88c8c88888c8c8888888888888ccc8c8c88888888888888ccc8cccc888888c888888ccc8c8c88888c8c888888888888c88c88c8c88888c8c888888888888cccc88c8c88888c8c88888888c8
c88c8c8c8c88888c8ccc8888888888c88c88c8c888888888cccccccc8c8c88888c8ccc8888888888c88c88c8c888888888cccccccc888c8888888c88888c88c88c8c88888c8ccc8888888888c88c88c8c88888c8ccc8888888888c88c88c8c88888c8ccc888888cccccccc888c8888888c8cccccccc8c8c8888888888888c88c88c8c88888c8ccc888888cccccccc8c8c88888c8ccc8888888888c88c8888c8888888c8cccccccc8c8c88888c8ccc8888888888c88c8888c8888888c8cccccccc8c8c888888888cccccccc888c8888888c8cccccccc8c8c888888888cccccccc888c8888888c88888c88c8888c8888888c88888c88c88c8c88888c8ccc8888888888c88c88c8c888888888cccccccc8c8c88888c8ccc888888cccccccc8c8c88888c8ccc888888cccccccc888c8888888c8cccccccc8c8c8888888888888c88c88c8c88888c8ccc8888888888c88c8888c8888888c88888c88c8888c8888888c8cccccccc8c8c888888888cccccccc888c8888888c88888c88c8888c8888888c88888c88c8888c8888888c8cccccccc8c8c888888888cccccccc8c8c88888c8ccc888888cccccccc888c8888888c88888c88c8888c8888888c8cccccccc8c8c8888888888888c88c88c8c88888c8ccc888888cccccccc8c8c888888888cccccccc888c8888888c8cccccccc8c8c88888c8ccc8888888888c88c88c8c88888c8ccc8888888888c88c88c8c88888c8ccc888888c8
cccccc8c8ccccc8c888c8cccc8ccc8ccccc8c8ccccc8ccc8cc8c8ccc8c8ccccc8c888c8cccc8ccc8ccccc8c8ccccc8ccc8cc8c8ccc888ccccc8ccc8ccc8c88cc8c8ccccc8c888c8cccc8ccc8ccccc8c8ccccc8c888c8cccc8ccc8c88cc8c8ccccc8c888c8cccc8cc8c8ccc888ccccc8ccc8cc8c8ccc8c8ccccc8ccc8ccc8ccccc8c8ccccc8c888c8cccc8cc8c8ccc8c8ccccc8c888c8cccc8ccc8c88cc888ccccc8ccc8cc8c8ccc8c8ccccc8c888c8cccc8ccc8c88cc888ccccc8ccc8cc8c8ccc8c8ccccc8ccc8cc8c8ccc888ccccc8ccc8cc8c8ccc8c8ccccc8ccc8cc8c8ccc888ccccc8ccc8ccc8c88cc888ccccc8ccc8ccc8c88cc8c8ccccc8c888c8cccc8ccc8ccccc8c8ccccc8ccc8cc8c8ccc8c8ccccc8c888c8cccc8cc8c8ccc8c8ccccc8c888c8cccc8cc8c8ccc888ccccc8ccc8cc8c8ccc8c8ccccc8ccc8ccc8ccccc8c8ccccc8c888c8cccc8ccc8c88cc888ccccc8ccc8ccc8c88cc888ccccc8ccc8cc8c8ccc8c8ccccc8ccc8cc8c8ccc888ccccc8ccc8ccc8c88cc888ccccc8ccc8ccc8c88cc888ccccc8ccc8cc8c8ccc8c8ccccc8ccc8cc8c8ccc8c8ccccc8c888c8cccc8cc8c8ccc888ccccc8ccc8ccc8c88cc888ccccc8ccc8cc8c8ccc8c8ccccc8ccc8ccc8ccccc8c8ccccc8c888c8cccc8cc8c8ccc8c8ccccc8ccc8cc8c8ccc888ccccc8ccc8cc8c8ccc8c8ccccc8c888c8cccc8ccc8c88cc8c8ccccc8c888c8cccc8ccc8ccccc8c8ccccc8c888c8cccc8c8
88cc888ccccccccccccc8c88c8cccccc8cc8ccccccccccc8cc8c8c888ccccccccccccc8c88c8cccccc8cc8ccccccccccc8cc8c8c888888888c8c888ccccccccc8ccccccccccccc8c88c8cccccc8cc8ccccccccccccc8c88c8ccccccccc8ccccccccccccc8c88c8cc8c8c888888888c8c888cc8c8c888ccccccccccc8cccccc8cc8ccccccccccccc8c88c8cc8c8c888ccccccccccccc8c88c8ccccccccc8888888c8c888cc8c8c888ccccccccccccc8c88c8ccccccccc8888888c8c888cc8c8c888ccccccccccc8cc8c8c888888888c8c888cc8c8c888ccccccccccc8cc8c8c888888888c8c888ccccccccc8888888c8c888ccccccccc8ccccccccccccc8c88c8cccccc8cc8ccccccccccc8cc8c8c888ccccccccccccc8c88c8cc8c8c888ccccccccccccc8c88c8cc8c8c888888888c8c888cc8c8c888ccccccccccc8cccccc8cc8ccccccccccccc8c88c8ccccccccc8888888c8c888ccccccccc8888888c8c888cc8c8c888ccccccccccc8cc8c8c888888888c8c888ccccccccc8888888c8c888ccccccccc8888888c8c888cc8c8c888ccccccccccc8cc8c8c888ccccccccccccc8c88c8cc8c8c888888888c8c888ccccccccc8888888c8c888cc8c8c888ccccccccccc8cccccc8cc8ccccccccccccc8c88c8cc8c8c888ccccccccccc8cc8c8c888888888c8c888cc8c8c888ccccccccccccc8c88c8ccccccccc8ccccccccccccc8c88c8cccccc8cc8ccccccccccccc8c88c8c8
88c8888888888c8cccccccccc888c8c88888888888c8c888888c8c888888888c8cccccccccc888c8c88888888888c8c888888c8c888888888c8c88888c8c88888888888c8cccccccccc888c8c88888888888c8cccccccccc888c8c88888888888c8cccccccccc8888c8c888888888c8c888888c8c888888888c8c88888c8c88888888888c8cccccccccc8888c8c888888888c8cccccccccc888c8c88888888888c8c888888c8c888888888c8cccccccccc888c8c88888888888c8c888888c8c888888888c8c888888c8c888888888c8c888888c8c888888888c8c888888c8c888888888c8c88888c8c88888888888c8c88888c8c88888888888c8cccccccccc888c8c88888888888c8c888888c8c888888888c8cccccccccc8888c8c888888888c8cccccccccc8888c8c888888888c8c888888c8c888888888c8c88888c8c88888888888c8cccccccccc888c8c88888888888c8c88888c8c88888888888c8c888888c8c888888888c8c888888c8c888888888c8c88888c8c88888888888c8c88888c8c88888888888c8c888888c8c888888888c8c888888c8c888888888c8cccccccccc8888c8c888888888c8c88888c8c88888888888c8c888888c8c888888888c8c88888c8c88888888888c8cccccccccc8888c8c888888888c8c888888c8c888888888c8c888888c8c888888888c8cccccccccc888c8c88888888888c8cccccccccc888c8c88888888888c8cccccccccc8c8
88cccccccccccc8888888cccccccc8ccccccccccccc8cccccccc8ccccccccccc8888888cccccccc8ccccccccccccc8cccccccc8ccccccccccc8ccccccc8ccccccccccccc8888888cccccccc8ccccccccccccc8888888cccccccc8ccccccccccccc8888888ccccccccc8ccccccccccc8cccccccc8ccccccccccc8ccccccc8ccccccccccccc8888888ccccccccc8ccccccccccc8888888cccccccc8ccccccccccccc8cccccccc8ccccccccccc8888888cccccccc8ccccccccccccc8cccccccc8ccccccccccc8cccccccc8ccccccccccc8cccccccc8ccccccccccc8cccccccc8ccccccccccc8ccccccc8ccccccccccccc8ccccccc8ccccccccccccc8888888cccccccc8ccccccccccccc8cccccccc8ccccccccccc8888888ccccccccc8ccccccccccc8888888ccccccccc8ccccccccccc8cccccccc8ccccccccccc8ccccccc8ccccccccccccc8888888cccccccc8ccccccccccccc8ccccccc8ccccccccccccc8cccccccc8ccccccccccc8cccccccc8ccccccccccc8ccccccc8ccccccccccccc8ccccccc8ccccccccccccc8cccccccc8ccccccccccc8cccccccc8ccccccccccc8888888ccccccccc8ccccccccccc8ccccccc8ccccccccccccc8cccccccc8ccccccccccc8ccccccc8ccccccccccccc8888888ccccccccc8ccccccccccc8cccccccc8ccccccccccc8cccccccc8ccccccccccc8888888cccccccc8ccccccccccccc8888888cccccccc8ccccccccccccc8888888cccccc8
8888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888

And the image version which only outputs Love:

enter image description here

Output is quote 13:

"Love means never having to say you're sorry." - Jennifer Cavilleri Barrett

Previously forbidden:

?!"#$%&'()*+,-./01235679:;<=>@[\]^_` AbBCdDeEfFgGhHiIjJkKlLmMnNoOpPqQrRstTuUvVwWxXyYzZ{|}~

Remaining characters: 4 8 a c

Generator (in CJam)

q{i2b8Ue[~}%ee2af.%2aa..+
{~
[["888888888888888888888888
888888888888888888888888
888888888888ccc888888888
8888888cccccccc888888888
8888888cc8c8ccc888ccccc8
88c8888cc8c8c888888888c8
88c8888888c8c888888888c8
88ccccccccc8ccccccccccc8
888888888888888888888888"
"8888888888888888888888888
88888888888cccc8888888888
88888888888c88c8888888888
88888888888c88c8888888888
8888888ccc8c88cc888ccccc8
88c8888ccccccccc8888888c8
88c888888c8c88888888888c8
88cccccccc8ccccccccccccc8
8888888888888888888888888"
"8888888888888888888888888
8888888888888888888888888
88888888888cccc8888888888
88888888888c88c8888888888
8888888ccc8ccccc888ccccc8
88c8888cccccc8cc8888888c8
88c888888c8c88888888888c8
88cccccccc8ccccccccccccc8
8888888888888888888888888"]
["8888888888888888888888
ccc88888ccc88888888888
c8c88888c8c88888888888
c8c88888c8ccc888888888
c8888888c888c888cccc88
ccccccccccccc888888c88
88888888cccccccccccc88
8888888888888888888888
8888888888888888888888"
"8888888888888888
ccc8888888888888
c8c8888888888888
c8c8888888888888
c888888888ccc888
ccccccccccccc888
8888888888888888
8888888888888888
8888888888888888"
"8888888888888888
ccccccccccccc888
cccc88888888c888
88c888888888c888
8888888888ccc888
8888888888888888
8888888888888888
8888888888888888
8888888888888888"]
["c88888888888888
c8cc88888888888
c8cccc888888888
c88c8c888888888
cccccc888ccccc8
88cc888888888c8
88c8888888888c8
88cccccccccccc8
888888888888888"
"c888888888888888
c888888888888888
c8cccc8888888888
c8c88c8888888888
c8c88c8888ccccc8
c8c88ccc888888c8
cccccccc888888c8
88ccccccccccccc8
8888888888888888"]]
@=T@:T-=}%
_,
["88888888c8
88888888c8
88888888c8
88888888c8
88888888c8
88c88888c8
88c88888c8
88ccccccc8
8888888888"
"88c
88c
88c
88c
888
888
888
888
888"]=a+
Nf/{1$z,8-S*f{\+}..e>}*
z{_2$=1$'ce=1=&{;}*}*]zN*N

My last language to use.

\$\endgroup\$
2
  • \$\begingroup\$ Yay! Looks like we can finally complete this. \$\endgroup\$
    – kennytm
    Jun 8 '16 at 4:11
  • \$\begingroup\$ @kennytm Now your turn. \$\endgroup\$
    – jimmy23013
    Jun 5 '17 at 18:46
4
\$\begingroup\$

93. Ruby, uses no y

$><< '"Nobod' + "\u{79} \u{70}uts Bab\u{79}" + ' in a corner." - Johnn' + "\u{79} Castle"

Output is quote 98:

"Nobody puts Baby in a corner." - Johnny Castle

Previously forbidden: p

\$\endgroup\$
4
\$\begingroup\$

74. Deadfish~, uses no X

iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiciiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciciiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiicciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiciciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiciiiiiiiiiic

Output is quote 75:

"I have always depended on the kindness of strangers." - Blanche DuBois

Previously forbidden: py3\" ';({s[)<+.@=-,

Not a BF variant! Works with the Python interpreter on esolang wiki, but it only prints out the first few characters before it blows the stack (!?)

\$\endgroup\$
3
  • \$\begingroup\$ X? lame... ;) \$\endgroup\$ Oct 29 '14 at 12:45
  • 3
    \$\begingroup\$ @MartinBüttner I'm sniping :P esolangs.org/wiki/Puzzlang \$\endgroup\$
    – Sp3000
    Oct 29 '14 at 12:45
  • 9
    \$\begingroup\$ I think 0 would snipe a lot more. ;) \$\endgroup\$ Oct 29 '14 at 12:46
4
\$\begingroup\$

68. WASD (uses no >)

I wrote a Haskell program to generate this. This is my first time doing actual coding in a BF derivative/equivalent. This is a coup de grâce to most future BF-derivatives, as now all [].,+-<> are all forbidden.

wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwedwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwed

Output is quote 65:

"Elementary, my dear Watson." - Sherlock Holmes

Previously forbidden: py3\" ';({s[)<+.@=-,X0*/&]

Here is my interpreter, which is mostly identical to the one linked on the Esolangs page, except that it prints chars on the same line.

\$\endgroup\$
1
  • \$\begingroup\$ @Calvin'sHobbies Fixing it now! \$\endgroup\$ Oct 30 '14 at 1:38
4
\$\begingroup\$

63. Rexx (uses no v)

CALL    d2c 48
PARSE   VAR RESULT  Z
CALL    d2c 51
PARSE   VAR RESULT  T
CALL    x2c 224C697||T||74656E2||Z||746F2||Z||7468656D2E2||Z||4||T||68696C6472656E2||Z||6F662||Z||7468652||Z||6E696768742E2||Z||576861742||Z||6D757||T||696||T||2||Z||746865792||Z||6D616B652E222||Z||2D2||Z||4||T||6F756E742||Z||4472616||T||756C61
SAY RESULT

Output is quote 83.

"Listen to them. Children of the night. What music they make." - Count Dracula

Previously forbidden: "'&()*+-,./\03;<=>@X[soy pez]{}


I used the interpreter in http://www.compileonline.com/execute_rexx_online.php.

\$\endgroup\$
4
\$\begingroup\$

56. URSL (uses no #)

i1i1a91m11m11m19a19w1a21m29a29a29a29i2w2a41a42c4c4c4c4c4c4c4c4w4w4a59a51a52i5w5c1c1w1a65a69a69a69a69i6w6q6c5w5q5c6c6c6c6w6q6a59i5w5q5w1i4w4w5a49i4w4c4c4c4c4w4c5c5c5c5w5c4w4a59a59i5w5w1c4w4q4a49a49a49a49i4w4q4a49i4w4q4w5q5n45a49w4q4a89i8m89m89a81w8w1c4c4c4w4a59w5c5w5w1k5w5k5w5k5w5k5w5w1a49i4w4c5c5c5c5w5w4c5w5c5c5c5c5w5w4c6c6w6w1k4w4k4w4k4w4k4w4k4w4c6w6a89w8a19w1c1c1w1c8w8w1a29w2w5c4c4w4c5w5c4c4w4a49a49w4a59a59w5w1m19n12a19i1w1a18c1w1w6w5w4w1c1w1w4

Output is quote 58:

"Keep your friends close, but your enemies closer." - Michael Corleone

Previously forbidden: "'&()*+-,./\037;<=>@_[sovy pezxX]^{}~|

Writing this by hand was quite the job. I could've done it with a script to only use i1, c1 and w1, but wanted to make at least a little optimized version. It even uses the queue to store repeated bits.

In case someone is interested, here is my work text file:

i1 i1 a91 m11 m11 m19 a19 w1         //  -  34  -  -   -   -   -  -  -  2 "
a21 m29 a29 a29 a29 i2 w2            //  -  34 75  -   -   -   -  -  -  2 "K
a41 a42 c4 c4 c4 c4 c4 c4 c4 c4 w4   //  -  34 75  - 101   -   -  -  -  2 "Ke
w4                                   //  -  34 75  - 101   -   -  -  -  2 "Kee
a59 a51 a52 i5 w5                    //  -  34 75  - 101 112   -  -  -  2 "Keep
c1 c1 w1                             //  -  32 75  - 101 112   -  -  -  2 "Keep 
a65 a69 a69 a69 a69 i6 w6 q6         //  -  32 75  - 101 112 121  -  -  2 "Keep y
c5 w5 q5                             //  -  32 75  - 101 111 121  -  -  2 "Keep yo
c6 c6 c6 c6 w6 q6                    //  -  32 75  - 101 111 117  -  -  2 "Keep you
a59 i5 w5 q5                         //  -  32 75  - 101 114 117  -  -  2 "Keep your
w1                                   //  -  32 75  - 101 114 117  -  -  2 "Keep your 
i4 w4                                //  -  32 75  - 102 114 117  -  -  2 "Keep your f
w5                                   //  -  32 75  - 102 114 117  -  -  2 "Keep your fr
a49 i4 w4                            //  -  32 75  - 105 114 117  -  -  2 "Keep your fri
c4 c4 c4 c4 w4                       //  -  32 75  - 101 114 117  -  -  2 "Keep your frie
c5 c5 c5 c5 w5                       //  -  32 75  - 101 110 117  -  -  2 "Keep your frien
c4 w4                                //  -  32 75  - 100 110 117  -  -  2 "Keep your friend
a59 a59 i5 w5                        //  -  32 75  - 100 115 117  -  -  2 "Keep your friends
w1                                   //  -  32 75  - 100 115 117  -  -  2 "Keep your friends 
c4 w4 q4                             //  -  32 75  -  99 115 117  -  -  2 "Keep your friends c
a49 a49 a49 a49 i4 w4 q4             //  -  32 75  - 108 115 117  -  -  2 "Keep your friends cl
a49 i4 w4 q4                         //  -  32 75  - 111 115 117  -  -  2 "Keep your friends clo
w5 q5                                //  -  32 75  - 111 115 117  -  -  2 "Keep your friends clos
n45 a49 w4 q4                        //  -  32 75  - 101 115 117  -  -  2 "Keep your friends close
a89 i8 m89 m89 a81 w8                //  -  32 75  - 101 115 117  - 44  2 "Keep your friends close,
w1                                   //  -  32 75  - 101 115 117  - 44  2 "Keep your friends close, 
c4 c4 c4 w4                          //  -  32 75  -  98 115 117  - 44  2 "Keep your friends close, b
a59 w5                               //  -  32 75  -  98 117 117  - 44  2 "Keep your friends close, bu
c5 w5                                //  -  32 75  -  98 116 117  - 44  2 "Keep your friends close, but
w1                                   //  -  32 75  -  98 116 117  - 44  2 "Keep your friends close, but 
k5 w5 k5 w5 k5 w5 k5 w5              //  -  32 75  -  98 114 117  - 44  2 "Keep your friends close, but your
w1                                   //  -  32 75  -  98 114 117  - 44  2 "Keep your friends close, but your 
a49 i4 w4                            //  -  32 75  - 101 114 117  - 44  2 "Keep your friends close, but your e
c5 c5 c5 c5 w5                       //  -  32 75  - 101 110 117  - 44  2 "Keep your friends close, but your en
w4                                   //  -  32 75  - 101 110 117  - 44  2 "Keep your friends close, but your ene
c5 w5                                //  -  32 75  - 101 109 117  - 44  2 "Keep your friends close, but your enem
c5 c5 c5 c5 w5                       //  -  32 75  - 101 105 117  - 44  2 "Keep your friends close, but your enemi
w4                                   //  -  32 75  - 101 105 117  - 44  2 "Keep your friends close, but your enemie
c6 c6 w6                             //  -  32 75  - 101 105 115  - 44  2 "Keep your friends close, but your enemies
w1                                   //  -  32 75  - 101 105 115  - 44  2 "Keep your friends close, but your enemies 
k4 w4 k4 w4 k4 w4 k4 w4 k4 w4        //  -  32 75  - 101 105 115  - 44  2 "Keep your friends close, but your enemies close
c6 w6                                //  -  32 75  - 101 105 114  - 44  2 "Keep your friends close, but your enemies closer
a89 w8                               //  -  32 75  - 101 105 114  - 46  2 "Keep your friends close, but your enemies closer.
a19 w1                               //  -  34 75  - 101 105 114  - 46  2 "Keep your friends close, but your enemies closer."
c1 c1 w1                             //  -  32 75  - 101 105 114  - 46  2 "Keep your friends close, but your enemies closer." 
c8 w8                                //  -  32 75  - 101 105 114  - 45  2 "Keep your friends close, but your enemies closer." -
w1                                   //  -  32 75  - 101 105 114  - 45  2 "Keep your friends close, but your enemies closer." - 
a29 w2                               //  -  32 77  - 101 105 114  - 45  2 "Keep your friends close, but your enemies closer." - M
w5                                   //  -  32 77  - 101 105 114  - 45  2 "Keep your friends close, but your enemies closer." - Mi
c4 c4 w4                             //  -  32 77  -  99 105 114  - 45  2 "Keep your friends close, but your enemies closer." - Mic
c5 w5                                //  -  32 77  -  99 104 114  - 45  2 "Keep your friends close, but your enemies closer." - Mich
c4 c4 w4                             //  -  32 77  -  97 104 114  - 45  2 "Keep your friends close, but your enemies closer." - Micha
a49 a49 w4                           //  -  32 77  - 101 104 114  - 45  2 "Keep your friends close, but your enemies closer." - Michae
a59 a59 w5                           //  -  32 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael
w1                                   //  -  32 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael 
m19 n12 a19 i1 w1                    //  -  64 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael C
a18 c1 w1                            //  - 111 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael Co
w6                                   //  - 111 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael Cor
w5                                   //  - 111 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael Corl
w4                                   //  - 111 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael Corle
w1                                   //  - 111 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael Corleo
c1 w1                                //  - 110 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael Corleon
w4                                   //  - 110 77  - 101 108 114  - 45  2 "Keep your friends close, but your enemies closer." - Michael Corleone
\$\endgroup\$
4
+100
\$\begingroup\$

55. Grass (uses no d)

It is here: http://pastebin.com/Cm6iiVb4

Bzip2|base64:

QlpoOTFBWSZTWZyk5MYAA45////////////////////////////////////////////4QAG8DnOc
YoAJgATEwmCYmCYBMmE0wATAhgCYAAAIYBMAEYJgAmmARgBMTAAACYARgNDTCaNpEAAAAAAAAAAA
AAAAAADQaAAAAAAAAAAAAAAAAAAAAAAAAciYAAAAA00Tyepk0DQAAAaGk8iYTahhGAAAAABMmQaY
mAJgATTAE00NGAE0aYAAAAAGnqqKGgDQDQGjTQAAA0AAAADQB6jQAAAGgAAaAAAAAAAAAAAAADQA
AAN+ql/hUCZAyWWGeCYECTAkMIECEIEhhAhCQJkDAmQMmQMwMCZMzMnrnoAAAAAAAAAAAAAAAAAA
AAAAAAJkmT0SZJKBjj9FpLLJXaIB6+g4CGho9M4OYxp9crndrfeIWdv89ISeYC2Qj9UX0vSgWSSI
J4mZkmBgTMyTAyZMyeAMAACYAYECSBEQIEDBoaEERQqMFR/CGDpAUBJDACBKUKSxSYHAAEBE1GEh
E4Mni1BRUkhTVEpVVldYWVpbXF0WvL7AwsTGyMoxmZ2ga0+IcPamvxjGxtbm/yOA0h5R3m844e4u
RBxc3QA0NgBub3AC4gQLk5uTo5urs7vDy9Pb0+Er6/P8BAwUHCQsNDxETFRcZGx0fISMlJykpKy0
vMTM1Nzk7PT9BQ0VHSUtNT1FTVVdZW11fYWNlZ2lrbW9xc3V3eXt9f4GDhYeJi4eJi42PkZOVl5m
bnZ+ho6Wnqaut/dfY2drb3N3e3+D/f/h4uPk5ebnDdHT1B+sQJFC+wZ29w0KoACHCPmAAACAQjwI
IAAI8EOFDAhoQ0SLF+AYWFfT0DA5EHDBw3XHfm7+Od+4pznOdFf5zpoyUhSTAmZMkL/i7kinChIT
lJyYwA==

Output is quote 52:

"You had me at "hello."" - Dorothy Boyd

Previously forbidden: "#'&()*+-,./\037;<=>@_[sovy pezxX]^{}~|

Tested in the Python interpreter. (The Ruby one is broken in the current Ruby version and can be fixed by adding a .ord.)

It can probably be golfed better by copying Out and making the main function do different things (like increase by 16) by checking a condition.

Generator script in CJam:

"wWWWwwww"254,{4+'W*'w+}%255q{256+'wm256%_-4?\)_)'W*\@1$\-'w*\}/;

The input should be the string to output.

\$\endgroup\$
4
\$\begingroup\$

47. A0A0 (uses no 5)

(Uses 60 newlines)

P89988898
P88988999
P98998898
P89989989
P89989989
P89989988
P98898988
P88889888
P99888998
P89989999
P98998898
P88889888
P99898988
P89889889
P98988899
P89889899
P88889888
P89989999
P99888998
P88889888
P89889889
P88889888
P98988898
P89989989
P89999988
P89999988
P89989989
P98998898
P88889888
P99898999
P89989999
P98998898
P89989988
P98898988
P88889888
P98998889
P98998899
P88889888
P99888999
P89989999
P89989999
P89989988
P88989998
P89988898
P88889888
P98898989
P88889888
P88988999
P89989999
P98998898
P89989988
P89989999
P89989998
P88889888
P88988999
P89989989
P89889899
P89889899
P89989999
P89989898

Output is quote 57:

"Greed, for lack of a better word, is good." - Gordon Gekko

Previously forbidden: "#&'()*+,-./0137:;<=>@[\]^_ deEhopQksvWxXyz{|}~

Remaining characters:

  • Symbols: ! $ % ? `
  • Numbers: 2 46 89
  • Uppercase: ABCD FGHIJKLMNOP RSTUV YZ
  • Lowercase: abc fg ij lmn qr tu w

You can run it with this interpreter. The language has some interesting features, but I'm only using the boring old P (for 'print') operator.

\$\endgroup\$
3
  • 1
    \$\begingroup\$ Interesting. Every number can be written as a series of 8 and 9 mod 256? \$\endgroup\$
    – kennytm
    Nov 15 '14 at 11:48
  • 2
    \$\begingroup\$ Yeah, I wrote a little Perl script to try to generate them and it worked. There are only 256 8-digit numbers consisting of only 8 and 9, so there must only be one such representation for each number. I'm sure there's some nifty mathematical proof in there, but I haven't figured it out yet. \$\endgroup\$ Nov 16 '14 at 19:28
  • 1
    \$\begingroup\$ @gone_native Yes. Take a number 0≤n≤255. If it even then pick 8 as your last digit, otherwise 9. Compute $((n-8)/2)/5$ or $((n-9)/2)/5$ accordingly, where the division by 2 is usual integer division and the division by 5 is modulo 128. Let that be your new n. Repeat: if odd, the (next to) last digit is 9, otherwise 8; divide (mod 64, then mod 32, etc); repeat. \$\endgroup\$ Nov 24 '14 at 0:10
4
\$\begingroup\$

39. Farm (uses no M)

(New lines are not necessary.)

COCORICO!
COT!
arf!arf!
Grunt!
CHIRP!
miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!
Grunt!
CHIRP!
Grunt!
arf!arf!arf!
Grunt!
arf!arf!arf!
Grunt!
miau!miau!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!
Grunt!
CHIRP!
arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!
Grunt!
COT!
arf!arf!arf!arf!arf!arf!arf!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!
Grunt!
CHIRP!
Grunt!
arf!arf!arf!
Grunt!
arf!arf!arf!
Grunt!
miau!miau!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
arf!
Grunt!
COT!
Grunt!
CHIRP!
miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!
Grunt!
CHIRP!
arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
miau!
Grunt!
COT!
arf!arf!arf!arf!arf!arf!arf!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
CHIRP!
arf!arf!arf!arf!
Grunt!
Grunt!
miau!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!
Grunt!
CHIRP!
Grunt!
arf!arf!arf!
Grunt!
arf!arf!arf!
Grunt!
miau!miau!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
arf!
Grunt!
COT!
Grunt!
CHIRP!
miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
miau!
Grunt!
COT!
arf!arf!arf!arf!arf!arf!arf!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!
Grunt!
CHIRP!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
CHIRP!
arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
miau!miau!miau!miau!miau!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!
Grunt!
arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
arf!arf!arf!arf!arf!
Grunt!
miau!miau!miau!
Grunt!
miau!miau!
Grunt!
arf!arf!arf!arf!arf!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
arf!
Grunt!
CHIRP!
Grunt!
arf!arf!arf!
Grunt!
arf!arf!arf!
Grunt!
miau!miau!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
arf!
Grunt!
arf!
Grunt!
COT!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
Grunt!
arf!arf!
Grunt!
CHIRP!
miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!
Grunt!
CHIRP!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
miau!miau!miau!
Grunt!
CHIRP!
arf!arf!arf!
Grunt!
COT!
Grunt!
CHIRP!
miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!miau!
Grunt!
CHIRP!
Grunt!
arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!arf!
Grunt!
COT!
arf!arf!
Grunt!
HOUUU!

Output is quote 36:

"Badges? We ain't got no badges! We don't need no badges! I don't have to show you any stinking badges!" - "Gold Hat"

Previously forbidden: "#$&'()*+,-./01357:;<=>@[\]^_ ABdeEghJLNopQksvWxXyz{|}~

Remaining characters:

  • Symbols: ! % ? `
  • Numbers: 2 4 6 89
  • Uppercase: CD FGHI K OP RSTUV YZ
  • Lowercase: abc f ij lmn qr tu w

Farm is yet another BF variant. It uses animal onomatopoeia for the commands. The interpreter ignores all non-letters, so I used ! to separate the commands (avoiding the spaces). Often one command can be expressed with multiple words (e.g. all of "ouah", "waf", "wau", "bark", "arf", "woof", "ouaf" mean the same, +), so we could choose the ones that avoid the forbidden characters.

Generator:

def encode(quote):
    cur_val = 0
    yield 'COCORICO!'
    for c in quote:
        code = ord(c)
        commands = [
            (cur_val, ''),
            (97, 'CHIRP!'),
            (32, 'COT!'),
        ]
        (cur_val, x) = min(commands, key=lambda c: abs(code - c[0]))
        if x:
            yield x
        if code > cur_val:
            yield 'arf!' * (code - cur_val)
        elif code < cur_val:
            yield 'miau!' * (cur_val - code)
        cur_val = code
        yield 'Grunt!'
    yield 'HOUUU!'
\$\endgroup\$
4
\$\begingroup\$

21. FlogScript (uses no G)

(New lines are required. There are 41 new lines)

4898
Pc2899
Pc884
Pc9829
Pc2924
Pc2924
Pc4449
Pc289
Pc288
Pc2888
Pc9829
Pc889
Pc44
Pc288
Pc2899
Pc884
Pc9829
Pc2924
Pc2924
Pc4449
Pc289
Pc4898
Pc288
Pc22829
Pc288
Pc2899
Pc884
Pc4449
Pc22894
Pc2924
Pc9829
Pc889
Pc288
Pc84299
Pc229999
Pc282999
Pc4449
Pc2924
Pc22899
Pc8299
Pc22889
Pc

Output is quote 45:

"Stella! Hey, Stella!" - Stanley Kowalski

Previously forbidden:

?!"#$%&'()*+,-./013567:;<=>@[\]^_` AbBCdeEFghIjJkLMNopqQRsTUvVWxXyYzZ{|}~

Remaining characters:

  • Symbols: none
  • Numbers: 2 4 89
  • Uppercase: D H K OP S
  • Lowercase: a c f i lmn r tu w

FlogScript is a stack-based programming language. The standard interpreter is written in PHP. The language itself is mostly undocumented.

This code uses the Pc command, which prints integer at the top of the stack as ASCII code. This uses the PHP chr() function, which automatically performs mod 256. So the encoder is pretty simple:

def encode(quote):
    for char in quote:
        c = ord(char)
        while set(str(c)) - set('2489'):
            c += 256
        yield '{}\nPc'.format(c)
\$\endgroup\$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.